Transcript asmbl_63323

Sequence
Transcript Sequence for observation asmbl_63323 of TGE0006531:
CAGGCGACGCCGAGTGAGGCTGAGGCTGGGGGCGAATCGCCGCAGAGCTGCGTGTCGGCATCGCACTCTGATTGGACAGCGGGGAAGCCTGTTAGCTTATTGGCCCCGCTGATCCCGCCCCATAGCGCGGGGCAGCCTTTAACCTTTAGCCCAAGCGGGCGCCAGCCACTCAGATCGCTTCTTGTTGGTATATGCAGCGGCAGTGGCCGCCGGCGGAGCAGTCTGAGCCAGACGATGAGGCCGGGGACGGGAGCCGAACGTGGAGGCCTCATGATGGGGCACCCTGGCATGCATTATGCCCCAATGGGAATGCACCCTATGGGTCAGAGAGCAAATATGCCTCCTGTACCTCATGGAATGATGCCGCAAATGATGCCCCCAATGGGAGGACCGCCAATGGGACAAATGCCTGGAATGATGTCTTCGGTAATGCCTGGAATGATGATGTCTCATATGTCTCAAGCTTCCATGCAGCCTGCCTTACCGCCAGGAGTAAATAATATGGATGTAGCAGCAGGTATGTATGCCATTTGTGGTGAAATCAATGTGGACTGAACATAAATCACCTGATGGAAGGACTTACTACTACAATACTGAAACAAAACAGTCTACTTGGGAGAAACCGGATGATCTTAAAACACCTGCTGAGCAACTTTTATCTAAATGCCCCTGGAAGGAATACAAATCTGACTCTGGAAAGCCTTACTATTACAATTCTCAAACAAAGGAATCCCGCTGGGCCAAACCTAAAGAACTTGAGGATCTTGAAGCAATGATCAAAGCTGAAGAAAGCAGTAAGCAAGAGGAGTGCACCACAGCATCAACAGCCCCAGTTCCTACAACAGAAATTCCGACCACAATGAGCACCATGGCTGCTGCAGAAGCAGCAGCTGCTGTCGTTGCAGCAGCCGCCGCTGCCGCAGCAGCCGCCGCTGCAGCCAATGCCAGTTCTTCCACCTCTGCTTCTAATACAGTGGGTGGAACTGTTCCGGCTGTTCCTGAGCCTGAAGTTACTTCAATTGTTGCTACTGTTGTAGATAATGAAAACACAGTAACAATTTCAACTGAGGAACAAGCACAACTTACTAGTACCCCTGCTGTTCAGGATCAAAGTGTTGAAGTGTCTAGTAATGCTGGAGAAGAAACATCAAAGCAGGAAACCTTAGCTGATTTTACTCCCAAGAAAGAAGAGGAGGAAAGCCAACCAGCAAAAAAAACATATACTTGGAATACAAAGGAGGAGGCAAAGCAAGCATTTAAAGAATTATTGAAAGAAAAGCGGGTACCATCTAATGCTTCATGGGAGCAAGCTATGAAAATGATCATTAATGACCCACGATACAGTGCTTTAGCAAAGTTGAGTGAAAAAAAGCAGGCCTTTAATGCTTATAAAGTCCAGACAGAGAAAGAAGAAAAAGAAGAAGCAAGATCAAAGTACAAAGAGGCTAAGGAATCCTTTCAGCGTTTTCTTGAAAATCATGAGAAAATGACTTCCACAACCAGATACAAAAAAGCAGAGCAAATGTTTGGAGAGATGGAAGTCTGGAATGCAATATCAGAACGTGATCGTCTTGAAATCTATGAAGATGTTTTATTCTTTCTTTCGAAAAAAGAAAAGGAGCAAGCAAAGCAATTGCGAAAGAGAAATTGGGAAGCCTTAAAAAACATACTTGACAACATGGCTAACGTAACATACTCAACTACTTGGTCAGAAGCCCAGCAGTATCTGATGGATAATCCAACTTTTGCAGAAGACGAGGAATTACAGAACATGGATAAAGAAGATGCATTAATTTGCTTTGAAGAACATATTCGTGCTTTAGAAAAGGAAGAAGAAGAAGAAAAACAGAAGAGTTTGCTGAGAGAAAGGAGACGACAGCGTAAAAACAGAGAATCTTTTCAGATATTTTTAGATGAGCTGCATGAACATGGACAACTGCATTCTATGTCATCTTGGATGGAATTGTATCCAACAATTAGTTCTGACATTAGATTCACTAATATGCTTGGTCAGCCGGGATCAACTGCACTTGACCTTTTCAAGTTTTATGTTGAGGATCTTAAAGCACGTTATCATGATGAGAAGAAGATAATAAAAGATATTCTAAAGGATAAAGGATTTGTAGTTGAAGTAAATACTACTTTTGAAGACTTTGTGGCAGTAATCAGTTCAACTAAAAGATCAACCACACTAGATGCTGGGAACATTAAGTTAGCTTTTAATAGTTTACTAGAAAAGGCAGAAGCCCGTGAACGTGAAAGAGAAAAAGAGGAGGCTCGGAAGATGAAACGAAAAGAATCTGCTTTTAAGAGTATGTTGAAACAAGCTACTCCTCCAATAGAATTGGATGCTGTCTGGGAAGATATCCGGGAGAGATTTGTAAAAGAGCCAGCATTTGAGGACATAACTCTAGAGTCTGAAAGAAAACGAATATTTAAAGATTTTATGCATGTGCTTGAGCATGAATGTCAGCATCATCATTCAAAGAACAAGAAACATTCTAAAAAATCTAAAAAACATCACAGGAAACGTTCCCGTTCTCGATCGGGGTCAGATTCAGATGACGACGACAGCCATTCAAAGAAAAAAAGACAGCGATCAGAGTCTCGTTCTGCTTCAGAACATTCTTCTAGTGCTGAGTCTGAGAGAAGTTACAAGAAGTCAAAAAAACATAAGAAGAAAAGCAAGAAGAGGAGGCATAAATCTGACTCTCCAGAGTCAGATGCTGAGCGAGAGAAGGATAAAAAAGAGAAAGACCGGGAAAGCGAAAAAGAGAGAACTAGACAAAGATCAGAATCAAAACACAAATCACCTAAGAAAAAGACTGGAAAGGATTCTGGTAATTGGGATACTTCTGGCAGTGAACTGAGTGAAGGGGAATTGGAAAAGCGCAGAAGGACCCTTTTGGAGCAACTGGATGATGATCAATAAATTATACCAAATATATGTTTACAGTATGGTTTAAAGTCTAATTCAGACCAGGGACTCTATTTTAAGTTCAATGGAAATAACACTGGGTTTTAATTATATCACAGGAGAAAAAAAAAGTGCATTTAAGTATTGTTATTGTGGACTTTATAAAAGCAAAGGAAATTGAAAGTAACTTTCGATTCTGTATCAAGAATCATATTTTCATACAGTCATGTCTTTGTGTCCCTTTCATAGGGCACCGCAGGATGGATTAAAGGTGGCAATTTACTGATAACTGCAAATGTCTCTACTTTGTTCTAAAGTCTAAGTGATGAGGTGATTTGATTTACTTTATAGAAGTTGGATTTTGAAGATATAGTGAAAAATTTTTTGATATCCAGTAGTACAAAAAAAGCACCAGCAACTGATAAAATGGCTTTTTTGTGCACTACCCCAACTGGTTAAAGCTGATCTTTTATGGTGAACCCAGAAATAGGTATTCTTAATGGAAACCTGGTAGACCCTTAACAATAGTGGTGCTAATGAGCACTGCTGTAATAAAGCCACCATTATTTTTTATGAAACATCTGAGTACATTTTAAAAAGGCTATTGTGAGGGCATTATTTTGAGGTGATGTTTAAAAAGTTAACATCAAATCAAATTGTAAATTAGTTTAAATATATTGCCTTAAGGACCTACTAAAGAATGTGCCACCAAACTTTAAGTGATAGTTGCAATATTCTTGTCTAAAACAAAAATCAATGTTGACAAACATTTCTTTAACAGTTGTCTTTTTTTTTTAAATCCGATCTTTCACTTGC