Transcript asmbl_63322

Sequence
Transcript Sequence for observation asmbl_63322 of TGE0006531:
CAGGCGACGCCGAGTGAGGCTGAGGCTGGGGGCGAATCGCCGCAGAGCTGCGTGTCGGCATCGCACTCTGATTGGACAGCGGGGAAGCCTGTTAGCTTATTGGCCCCGCTGATCCCGCCCCATAGCGCGGGGCAGCCTTTAACCTTTAGCCCAAGCGGGCGCCAGCCACTCAGATCGCTTCTTGTTGGTATATGCAGCGGCAGTGGCCGCCGGCGGAGCAGTCTGAGCCAGACGATGAGGCCGGGGACGGGAGCCGAACGTGGAGGCCTCATGGTGAGTGAAATGGAGAGCCATCCTCCCGCGCGGGGTGCTGGGGACGGGGAGCGGAGATTGTCCGGCTCAAGCCTCTGCTCCAGCTCTTGGGTCTCTGCTGACGGCTTCCTGAGGAGACGGCCCTCGATGGGGCACCCTGGCATGCATTATGCCCCAATGGGAATGCACCCTATGGGTCAGAGAGCAAATATGCCTCCTGTACCTCATGGAATGATGCCGCAAATGATGCCCCCAATGGGAGGACCGCCAATGGGACAAATGCCTGGAATGATGTCTTCGGTAATGCCTGGAATGATGATGTCTCATATGTCTCAAGCTTCCATGCAGCCTGCCTTACCGCCAGGAGTAAATAATATGGATGTAGCAGCAGGTATGTATGCCATTTGTGGTGAAATCAATGTGGACTGAACATAAATCACCTGATGGAAGGACTTACTACTACAATACTGAAACAAAACAGTCTACTTGGGAGAAACCGGATGATCTTAAAACACCTGCTGAGCAACTTTTATCTAAATGCCCCTGGAAGGAATACAAATCTGACTCTGGAAAGCCTTACTATTACAATTCTCAAACAAAGGAATCCCGCTGGGCCAAACCTAAAGAACTTGAGGATCTTGAAGCAATGATCAAAGCTGAAGAAAGCAGTAAGCAAGAGGAGTGCACCACAGCATCAACAGCCCCAGTTCCTACAACAGAAATTCCGACCACAATGAGCACCATGGCTGCTGCAGAAGCAGCAGCTGCTGTCGTTGCAGCAGCCGCCGCTGCCGCAGCAGCCGCCGCTGCAGCCAATGCCAGTTCTTCCACCTCTGCTTCTAATACAGTGGGTGGAACTGTTCCGGCTGTTCCTGAGCCTGAAGTTACTTCAATTGTTGCTACTGTTGTAGATAATGAAAACACAGTAACAATTTCAACTGAGGAACAAGCACAACTTACTAGTACCCCTGCTGTTCAGGATCAAAGTGTTGAAGTGTCTAGTAATGCTGGAGAAGAAACATCAAAGCAGGAAACCTTAGCTGATTTTACTCCCAAGAAAGAAGAGGAGGAAAGCCAACCAGCAAAAAAAACATATACTTGGAATACAAAGGAGGAGGCAAAGCAAGCATTTAAAGAATTATTGAAAGAAAAGCGGGTACCATCTAATGCTTCATGGGAGCAAGCTATGAAAATGATCATTAATGACCCACGATACAGTGCTTTAGCAAAGTTGAGTGAAAAAAAGCAGGCCTTTAATGCTTATAAAGTCCAGACAGAGAAAGAAGAAAAAGAAGAAGCAAGATCAAAGTACAAAGAGGCTAAGGAATCCTTTCAGCGTTTTCTTGAAAATCATGAGAAAATGACTTCCACAACCAGATACAAAAAAGCAGAGCAAATGTTTGGAGAGATGGAAGTCTGGAATGCAATATCAGAACGTGATCGTCTTGAAATCTATGAAGATGTTTTATTCTTTCTTTCGAAAAAAGAAAAGGAGCAAGCAAAGCAATTGCGAAAGAGAAATTGGGAAGCCTTAAAAAACATACTTGACAACATGGCTAACGTAACATACTCAACTACTTGGTCAGAAGCCCAGCAGTATCTGATGGATAATCCAACTTTTGCAGAAGACGAGGAATTACAGAACATGGATAAAGAAGATGCATTAATTTGCTTTGAAGAACATATTCGTGCTTTAGAAAAGGAAGAAGAAGAAGAAAAACAGAAGAGTTTGCTGAGAGAAAGGAGACGACAGCGTAAAAACAGAGAATCTTTTCAGATATTTTTAGATGAGCTGCATGAACATGGACAACTGCATTCTATGTCATCTTGGATGGAATTGTATCCAACAATTAGTTCTGACATTAGATTCACTAATATGCTTGGTCAGCCGGGATCAACTGCACTTGACCTTTTCAAGTTTTATGTTGAGGATCTTAAAGCACGTTATCATGATGAGAAGAAGATAATAAAAGATATTCTAAAGGATAAAGGATTTGTAGTTGAAGTAAATACTACTTTTGAAGACTTTGTGGCAGTAATCAGTTCAACTAAAAGATCAACCACACTAGATGCTGGGAACATTAAGTTAGCTTTTAATAGTTTACTAGAAAAGGCAGAAGCCCGTGAACGTGAAAGAGAAAAAGAGGAGGCTCGGAAGATGAAACGAAAAGAATCTGCTTTTAAGAGTATGTTGAAACAAGCTACTCCTCCAATAGAATTGGATGCTGTCTGGGAAGATATCCGGGAGAGATTTGTAAAAGAGCCAGCATTTGAGGACATAACTCTAGAGTCTGAAAGAAAACGAATATTTAAAGATTTTATGCATGTGCTTGAGCATGAATGTCAGCATCATCATTCAAAGAACAAGAAACATTCTAAAAAATCTAAAAAACATCACAGGAAACGTTCCCGTTCTCGATCGGGGTCAGATTCAGATGACGACGACAGCCATTCAAAGAAAAAAAGACAGCGATCAGAGTCTCGTTCTGCTTCAGAACATTCTTCTAGTGCTGAGTCTGAGAGAAGTTACAAGAAGTCAAAAAAACATAAGAAGAAAAGCAAGAAGAGGAGGCATAAATCTGACTCTCCAGAGTCAGATGCTGAGCGAGAGAAGGATAAAAAAGAGAAAGACCGGGAAAGCGAAAAAGAGAGAACTAGACAAAGATCAGAATCAAAACACAAATCACCTAAGAAAAAGACTGGAAAGGATTCTGGTAATTGGGATACTTCTGGCAGTGAACTGAGTGAAGGGGAATTGGAAAAGCGCAGAAGGACCCTTTTGGAGCAACTGGATGATGATCAATAAATTATACCAAATATATGTTTACAGTATGGTTTAAAGTCTAATTCAGACCAGGGACTCTATTTTAAGTTCAATGGAAATAACACTGGGTTTTAATTATATCACAGGAGAAAAAAAAAGTGCATTTAAGTATTGTTATTGTGGACTTTATAAAAGCAAAGGAAATTGAAAGTAACTTTCGATTCTGTATCAAGAATCATATTTTCATACAGTCATGTCTTTGTGTCCCTTTCATAGGGCACCGCAGGATGGATTAAAGGTGGCAATTTACTGATAACTGCAAATGTCTCTACTTTGTTCTAAAGTCTAAGTGATGAGGTGATTTGATTTACTTTATAGAAGTTGGATTTTGAAGATATAGTGAAAAATTTTTTGATATCCAGTAGTACAAAAAAAGCACCAGCAACTGATAAAATGGCTTTTTTGTGCACTACCCCAACTGGTTAAAGCTGATCTTTTATGGTGAACCCAGAAATAGGTATTCTTAATGGAAACCTGGTAGACCCTTAACAATAGTGGTGCTAATGAGCACTGCTGTAATAAAGCCACCATTATTTTTTATGAAACATCTGAGTACATTTTAAAAAGGCTATTGTGAGGGCATTATTTTGAGGTGATGTTTAAAAAGTTAACATCAAATCAAATTGTAAATTAGTTTAAATATATTGCCTTAAGGACCTACTAAAGAATGTGCCACCAAACTTTAAGTGATAGTTGCAATATTCTTGTCTAAAACAAAAATCAATGTTGACAAACATTTCTTTAACAGTTGTCTTTTTTTTTTAAATCCGATCTTTCACTTGC