Transcript asmbl_11346

Sequence
Transcript Sequence for observation asmbl_11346 of TGE0003591:
GGACGGGGCAACCTTGGCCCCTCCGCGTTTCCGTCTTTTCCGGCAGTTGGGGCGCTTCCTGTTGTCTTCAGCCGCAACTGCCCCTCGTACCCTACCTCAGAGGCCCTCACCGGTTCCCTCCCTTCCTCTGGCCGGCTGGCTGCTGCCACTGGGGCTTCGCCTGTCCGCACTTCGAGACCGCTGGCCCGGCCGGCGTCTGCGGCTGTCCGCCGCCCCCAGTCCTGTCTCCCTCGGGGCCCTGCCATGGCAATGACAGGCTCAACACCTTGCTCGTCCATGAGTAATCACACAAAGGAAAGGGTGACAATGACCAAAGTGACACTGGAGAATTTTTATAGCAACCTTATCGCTCAACATGAAGAACGAGAAATGAGACAAAAGAAGTTAGAAAAAGTGATGGAAGAGGAAGGCCTAAAAGATGAAGAGAAACGACTCAGGAGATCAGCACATGCTCGGAAAGAAACAGAATTTCTTCGTTTAAAGAGAACAAGACTTGGATTGGAAGATTTTGAGTCCTTAAAAGTAATAGGCAGAGGAGCGTTTGGTGAGGTGCGGCTTGTTCAGAAGAAAGATACAGGACATGTATATGCAATGAAAATACTCCGTAAAGCAGATATGCTTGAAAAAGAGCAGGTTGGCCACATTCGTGCGGAGCGTGACATTCTAGTGGAGGCAGACAGTTTGTGGGTTGTGAAAATGTTCTATAGTTTTCAGGATAAGCTAAACCTCTACCTAATCATGGAGTTCCTGCCTGGAGGGGACATGATGACTCTACTGATGAAAAAAGACACCTTGACAGAAGAGGAGACTCAGTTTTATATAGCAGAAACAGTATTAGCTATAGACTCCATTCACCAGCTTGGATTCATCCACAGAGATATCAAACCAGACAACCTTCTTCTGGACAGCAAGGGCCATGTGAAACTTTCTGACTTCGGCCTTTGCACAGGACTGAAAAAAGCACATAGGACAGAATTTTATAGGAATCTGAACCACAGCCTCCCCAGTGATTTCACTTTCCAGAACATGAATTCCAAAAGGAAAGCAGAA