Transcript asmbl_6283

Sequence
Transcript Sequence for observation asmbl_6283 of TGE0006275:
CGCGCACACTGCAGGAGCTGCCGCCGCCGCAGCCCGCGCCTTTAAGGTCTCACCGCTTCCTCAGCAGAGACCTGGACTCAGCCGCCATGTCCGCCACGGAGGAGGTTGACGGGCTGGGCGTGTCCCGGCCGCACTATGGCTCTGTCCTGGATAATGAGAGACTCACTGCAGAGGAGATGGATGAAAGAAGACGTCAGAATGTGGCCTACGAATACCTTTGTCATTTGGAAGAAGCAAAGAGGTGGATGGAAGCATGTCTCGGGGAAGATCTGCCTCCCACCACAGAACTGGAGGAGGGGCTGAGGAATGGAGTCTATCTCGCCAAGCTAGGAAACTTCTTCTCTCCCAAGGTGGTGTCCCTGAAAAAAATCTATGATCGAGAGCAGACCAGATACAAGGCAACTGGCCTCCACTTTAGACACACTGATAATGTGATTCAGTGGTTGAATGCCATGGATGAGATTGGATTGCCTAAGATTTTTTATCCAGAAACTACAGATATCTATGATCGAAAGAACATGCCAAGATGTATCTACTGTATCCATGCACTCAGCTTATACCTATTCAAACTAGGCCTGGCTCCTCAGATTCAAGACCTGTATGGAAAGGTTGACTTCACAGAGGAAGAAATCAACAACATGAAGATTGAACTGGAGAAGTATGGGATCCAGATGCCTGCCTTCAGCAAGATCGGGGGCATCCTGGCTAATGAACTCTCAGTGGATGAAGCTGCATTACATGCCGCCGTTATTGCTATTAATGAAGCTGTTGACCGTAGAATTCCAGCTGACACGTTTGCAGCTTTGAAAAACCCCAATGCCATGCTTGTAAATCTTGAAGAGCCCTTGGCTTCCACCTACCAGGATATACTCTACCAGGCCAAGCAGGACAAAATGACAAATGCTAAAAACAGGACAGAAAACTCTGAGAGAGAGAGGGACGTTTATGAGGAGCTGCTCACTCAAGCTGAAATTCAAGGCAATATAAACAAAGTCAATACATTATCTGCATTAGCCAATATAGACCTGGCTTTGGATCAGGGAGCTGCTCCGGCCTTGTTCAGGGTTCTGCAGTCCCCGGCGTTGGGCCTTCGAGGACTGCAGCAGCAGAACAGCGACTGGTACCTCAAGCAGCTGCTAAGTGAGAGACAGCAGAAGAGACAGAGTGGCCAGGCTGATCCCCTGCAGAAGGAGGAGCTACAGGCTGGAGTGGACGCCGCCAACAGCGCCGCTCAGCAGTACCAGAGAAGGCTGGCAGCCGTGGCAGCGATTAATGCTGCCATCCAGAAGGGTGTGGCGGAGAAGACTGTTCTGGAACTCATGAATCCCGAAGCCCAGCTGCCCCAGGTGTATCCGTTTGCTGCCGATCTGTATCAGAAAGAGCTGGCTACCCTGCAGCAACAGAGTCCGGAACATAGCCTCACCCACCCCGAGCTCTCCGTTGCAGTGGAGATGTTGTCGTCAGTGGCCCTCATCAACAGGGCACTGGAGTCTGGAGACATGAACACTGTGTGGAAACAGCTGAGCAGTTCAGTTACAGGCCTTACCAATATTGAAGAAGAAAACTGTCAGAGGTATCTTGATGAGCTAATGAAGCTGAAAGCTCAGGCACGTGCAGAGAATAACGAATTTATCACCTGGAATGACATCCAAGCTTGTGTGGACCATGTGAATCTGGTGGTGCAGGAGGAACACGAGAGGATTTTAGCCATCGGTTTAATTAACGAAGCCCTGGATGAAGGCGATGCCCAAAAGACTCTGCAGGCCCTGCAGATTCCTGCAGCTAAACTTGAGGGCGTCCTGGCAGAAGTGGCCCAGCATTACCAGGACACACTGATCCGGGCAAAGAGAGAAAAAGCCCAGGAAACCCAAGATGAGTCAGCTGTGTTATGGTTGGATGAAATTCAGGGTGCAGTCTGGCAGTCCAACAAAGACACCCAAGAAGCACAGAGGTTTGCCTTAGGAATTTTTGCCATTAATGAGGCCGTGGACAGTGGTGACATTGGTAAAACACTGAGTGCCCTGCGTTCCCCTGACGTCGGCTTGTACGGAGTCATCCCTGAGTGTGGTGAAACTTACCAGAGTGACCTGGCCGAAGCTAAGAAGAAAAAACTGGCAGCAGGAGATAATAACAGCAAGTGGGCAAAGCACTGGGTGAAAGGTGGATATTATTATTACCACAATCTGGAGACCCAGGAAGGAGGATGGGATGAACCACCAGGCTTTGTGCAAAATTCTATGCAGCTTTCTCGGGAGGAAATCCAGAGTTCCATTTCTGGAGTGACTGCTGCATATAACCGAGAACAGCTTTGGCTGGCCAATGAAGGCTTGATCACCAAGCTGCAGGCTTGCTGCCGTGGATACTTAGTCCGACAGGAATTCCGGTCCAGGATGAATTTCCTGAAGAAACAAATCCCTGCCATCACCTGCATTCAGTCGCAGTGGAGAGGATACAAGCAGAAAAAGGCGTATCAAGACCGTTTAGCGTACCTGCACTCCCATAAAGACGAGGTGGTAAAGATTCAGTCCCTGGCGAGGATGCATCAAGCCAGAAAGCGCTATAGAGATCGCCTGCAGTATTTCCGAGACCACATAAACGACATTATCAAAATCCAGGCTTTTATTCGGGCAAACAAAGCTCGTGATGACTACAAGACTCTCATCAATGCTGAGGATCCGCCGATGGTCGTGGTCCGGAAATTTGTCCACCTGCTCGACCAGAGTGACCAAGATTTTCAGGAGGAGTTGGATCTTATGAAGATGCGGGAAGAGGTCATCACCCTCATTCGTTCCAACCAACAGCTGGAGAATGACCTCAATCTCATGGATATCAAAATCGGGCTGCTAGTGAAAAATAAAATCACACTGCAGGATGTAGTTTCCCACAGTAAAAAACTTACCAAAAAAAATAAGGAACAGTTGTCCGACATGATGATGCTAAACAAACAGAAAGGAGGTCTCAAAGCTTTGAGCAAGGAGAAGAGAGAGAAACTGGAAGCTTATCAACACTTGTTTTATTTATTGCAGACCAACCCCACCTATCTGGCCAAGCTGATTTTCCAGATGCCCCAGAACAAGTCCACCAAGTTCATGGACTCTGTGATCTTCACTCTCTACAACTATGCATCCAACCAGCGAGAGGAATACCTGCTCCTGCGGCTCTTTAAGACCGCCCTACAGGAGGAAATCAAGTCAAAAGTAGACCAGATTCAGGAGATTGTGACGGGAAATCCTACAGTTATTAAGATGGTTGTGAGTTTCAACCGTGGTGCCAGAGGCCAGAATGCCCTGAGACAGATCCTGGCCCCAGTCGTGAAGGAGATTATGGATGACAAGTCTCTCAACATCAAAACTGACCCCGTGGACATTTACAAGTCGTGGGTTAATCAGATGGAGTCTCAGACAGGAGAAGCAAGCAAACTGCCCTATGACGTGACTCCTGAGCAGGCTCTAGCTCATGAAGAGGTCAAGACACGTCTGGACAACTCCATCAGGAACATGCGGGCCGTGACAGACAAGTTCCTCTCCGCCATCATCAGCTCAGTGGACAAAATCCCCTACGGGATGCGCTTCATTGCCAAAGTGCTGAAGGACTCGCTGCACGAGAAGTTCCCTGATGCTGGTGAGGATGAGCTGCTGAAGATCATTGGCAACTTGCTTTACTATCGATACATGAATCCAGCCATTGTCGCTCCTGATGCCTTTGACATCATTGACCTGTCGGCAGGAGGCCAGCTTACCACAGACCAGCGCCGAAATCTTGGCTCCATTGCAAAGATGCTCCAACATGCAGCTTCCAATAAGATGTTTCTGGGAGATAATGCTCACTTAAGCATCATTAATGAGTATCTTTCCCAGTCCTACCAGAAATTCAGACGGTTTTTCCAAACTGCTTGTGATGTCCCAGAGCTTCAGGATAAATTCAATGTGGATGAGTACTCTGACCTAGTGACCCTCACCAAACCAGTGATCTACATTTCCATTGGTGAAATCATCAACACTCACACGCTCCTGTTAGATCACCAGGACGCCATTGCTCCGGAGCACAATGATCCAATCCACGAGCTGCTGGACGACCTTGGCGAGGTGCCCACCATTGAGTCCCTGATAGGAGAAAGCGCTGGCAATTTAAATGACCCAAATAAGGAGGCGCTGGCTAAGACAGAAGTGTCTCTCACACTGACCAACAAGTTTGATGTGCCTGGGGATGAGAATGCAGAAATGGATGCTCGGACCATCTTACTTAACACAAAACGTTTAATTGTGGATGTCATCCGGTTCCAGCCGGGAGAGACCTTGACTGAAATCCTAGAAACACCAGCCACCAGTGAACAGGAAGCAGAACATCAGAGGGCCATGCAGAGACGTGCTATCCGTGACGCCAAAACTCCTGACAAGATGAAAAAGTCAAAATTTGTAAAGGAAGACAGCAACCTCACTCTGCAGGAGAAGAAGGAAAAGATCCAGTCAGGCCTGAAGAAGCTAACGGAGCTTGGGACCGTGAACCCAAAGAACAAATACCAGGAACTAATCAACGACATTGCCAGGGATATTCGGAATCAGCGGAGATACCGCCAGAGGAGAAAGGCTGAGCTGGTGAAACTGCAGCAAACATACGCTGCTCTGAACTCTAAGGCCACCTTTTACGGAGAGCAGGTGGATTACTATAAAAGCTATATCAAAACCTGCTTGGATAACTTAGCCAGCAAGGGCAAGGTCTCCAAGAAGCCTAGGGAAATGAAAGGAAAGAAGAGCAAAAAGATTTCTCTTAAATATACAGCAGCAAGACTACATGAAAAAGGAGTCCTTCTGGAAATTGAGGACCTACAAGCGAATCAGTTTAAAAATGTTATCTTTGAAATCAGTCCAACAGAAGAAGTTGGAGACTTTGAAGTGAAAGCCAAATTCATGGGAGTTCAGATGGAGACGTTTATGCTACATTATCAGGACCTGCTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAGTAAATGTCAACCTTCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAACTGATCATTTGCTGCCAGCACAGAAGGATGAAGGAAAGAAGTGCTTCACGGTTACCTTCCTAGGGCCCTTTTTTACCCACTGGAAGCAGAGACCCAACCCACACGGTGCTCGATACACTCCCAATGCCACATCTTTAACTCTTCCCTCTCTGACTGGACATTTGTAGCCCCCTTTTCATAGCGAGATTGTATTTCAGGCTTAGTCTGACCCTTCTTATTCCTTCATTTTCTTCTGTCACTTAGGAAGGAGTGGGAACTTGACCAAAACCTATCTGTGTTGTTTATAATGGTCTTAGAGGTTGCATTACTATATTGTAAGCTTTGGTGTTTGTTTTAATCTGCATTAGGGATGGTGGGATTTGAATTCTTGTTATTTAGAAGTGGAAGCTGTTAGCACCAATGACATACATTGATATAAGACACAATCAAAATGTCAGATTACCCGTAGTTCTTCGGCTGTCATTTAAAAGTGAAGTTCCTTCACAGTAAAACGGAAGGATGTGGGGTATCATCGCTCCTCTTCTGTTTTGTTTCCCTTTATAGGCAGGAGCTAATAGAAGCCACTGTACTGTGTTCAGAGGAAGCATTTCTAGAAAAGGGGATGATATCATTTTTAAACTTTACCATCAAATTTGGACACTTCTGTTAGAGTAACTCTTGTCATTGAATGGTAGAGTCCCATTGATAAAATTCGGCCATTTAGGTGGATTTATAATGGTCTGTGGTGTCCCTCCTCTTTGAGGTGTCTGCTTGTCTGCTTCAGTGCAGAGATTGACTGGTTCAGGAAGATGGCCCACTTTGTCGCTGTGATAGAGGAATGGGTTAGCTTAGCTTAGGATATAATTTTTTTCAAAGCTGTTTTATATCTTAAGAGTGCCTTATTAAAGTGTAGATTTATTTCTTAAAATGTGGGTGATAGGAATTTTAAAGATTTATATAATGCTTCAAAGCCATTAGAATATGGTAAGAAAAGGTTTTTTAAAATGGGCTTATCTGTATATCTGAACTCTTAAAACTTTCTTATAGCTAAAACACTAGGATTTGTCTGCAGAGTCGCAGAGATAATCCTGCCTTAAGTAGATGGAAACAAAAATAAACAGAACCAGCCAACCAACGTTACACATGATATCAAGTCTGTTTCCCCATTTTTTTCTCTCTCCTCCTGCCCACACTGCTTTTATCTTATGAGCTCCAGTTTTCTGGGTTTAGTCAAAAAATTCAGTTCTAAACATTGAATTTCTAGGAAGTTTTTGTTCTTAGATAAAAAGTCATACTTTTTAAAAAAATCTGTTTATCCAGGAGAACAGTGAAATCATGCTACTGAGCCTCAATTTTCTCTGATATTTTGGTTCAGTATTCTTTTATCACAAAACATAAAACTTAACAAAATAAACTAACATCTATAAATTGATCTATGTATATTTAAATACAATAAACTGTTTTGTCAATAACAAATTATGTGATGTGTCCCTATTACAAATGTAAGTGCTGGAGACGTGTTTTTCATGATGCACTGTTTACTCAGTCAGGTCCATGGGTGCAAATGTACCCACTGCAGGCAGACCCCTGGCAGGTGAGGTGGGGCATGCCACTGACGGAAGGAGTCTCCGCTACCCTGACCTCGTTTTTTGTTGTATTTTGGAAGATAATTTTTTAGTAAATATTTTTCTTATATTAAAAGAAGATGCTATTGCAAGTAGCATCGCCTCAGAAACTGGGACCAATGCTTTTACCTTGAAGGAGGATGGATACCCATCGCGCATGTTTGTCAGGTTCCAAAGGCCACACCCATGACCGACAGTGAGCTGAGTTTACAACTCCTTTAATAAAACATGATGTTTCAATTATTTGTAAGGATTATAGTTCCCTTGACACAACATTTAATGCAAAGTAGCACAAAACGCACTTCGAGAGTTTTGATGGTGACTATATATTGAATTGTAGTTTTAATGACATTGAGAAGGCCCGGGTGAACTCAAGTGGCATTGAAACAGTGTAGTTCTTAGTCCTTTTATTTATTAGCTGTAGCGTTCTCCACCTTGTCTCTCTCCTTCTATGATCTTCTGTTCCACCAGCCATCGTGACATTTATCATGAATTTACCTCCTCCCAAGAATTCGGACTGCCTGCCCATCAGATTGTTGCCGCACACAATTGCCTTTGTATCTCTGTATGAAATAAAAGGTCAT