Transcript asmbl_62717

Sequence
Transcript Sequence for observation asmbl_62717 of TGE0006472:
GGAAGTGAAGTCCCCGAGCACGTTAGGAAGCCCGGCCACGGCCTGACTCCGGACAGGGCGGACGGGGTGCTCTGAGCTGTGGCCATCTGCCCGCATGAATGTTCTGAAGCCATCCTGTCCCTGGAGAAAACAGGGGTGAGGAGGAAGAACAGGGACTCGTGTGCCAGGAAGAACTCGGAGCCAGGAAGCCCCATTTGCTGGAAACACCAAGAGATGTGGCCCCCCTCACAGGGCCTGAATTTCCTGCTGCTATTCACAAAGATGCTTTTTATCTTTAACTTCTTGTTTTCCCCACTTCCAACTCCGGCACTGATCTGCATCCTGACCATTGGAGCTGCCATCTTCCTATGGCTGATGAACAGACCTCAGCCAGTCTTGCCTGATATTGATCTGAACAACCAGTCAGTGGAAATTGAGGGAGGAGCACGGAGGAGCGCAAAACAGAAAGACGACGAACTGCTCTCTTACTACTTCTCAGATGTCAAGACAATATACGAAGCTTTCCAAAGAGGACTGGTTGTATCTGGCAATGGGCCTTGCTTGGGATATAGAAAACCAAATCAGGACTACAGATGGCTGTCCTACAAACAGGTGTCTCATCGAGCAGAGTACCTGGGCTCCTGTCTCTTGCATAAAGGATATAAGCCATCACCAGACCAATTTGTTGGCATCTTTGCTCAGAATAGGCCAGAGTGGATCATCTCGGAGTTAGCTTGTTACACGTACTCCATGGTGCCTGTCCCCCTGTATGATACCTTGGGAGTAGAAGCTGTCGTGTACACTATCAACAAGGCTGATATTGCCATGGTGATCTGTGATACACTCCAAAAGGCATTGGTCCTGATAGGAAATGTGGAGAAGGGCCTCATCTCAGGCCTAAAAATAATCATCCTCATGAATTCCTTTGAAGATGACCTGAAGCAAAGAGGGGAGAAAAGTGGAATAGAGATCTTATCCTTCTCTGAAGCTGAGAATATAGGCAGAGAGAACTTCAGAAAACCCGTGCCACCTACACCAGAAGATCTGAGCATCATCTGCTTCACCAGTGGAACCACAGGTGAGCCCAAAGGGGCCATGCTAACCCATCAAAATGTCATTTCAAATGCTGCTGCTTTTCTCAAACTTTTGGAGGACAGCTTCCAGCCCACTCCCAAGGATGTGACCATATCCTACCTCCCCTTGGCTCATATGTTTGAGAGGGTTGTACAGGTTATTATGTACTCTTGTGGAGCCAGAGTTGGGTTCTTCCAGGGAGATATTCGGTTGCTGCCCGATGACATGAAGACTCTGAAGCCCACGGTGTTTCCCATAGTGCCTCGACTCCTTAACAGGATCTACAATAAGGTTCAAAATGAAGCAAAGACACCCTTGAAGAAGTTCTTGTTGAACTTGGCTGTTGCCAGTAAAATCAATGAAATGAAAAAGGGTATCATCAGACGCAACAGTTTCTGGGACAAGCTCATCTTTGCAAAGATCCAGGACAGCCTGGGTGGGAAGGTCTCCTTAATGATCACTGGAGCTGCCCCCATCGCCTCTCCTATCTTGACATTCTTCCGGGCAGCAATGGGATGTATGGTGCTTGAAGCTTATGGACAAACGGAATGCACTGCGGGCTGTACATCTACGTTACCTGGAGACTGGACGTCAGGCCATGTTGGAGTCCCTGTACCTTGCAATCACGTGAAGCTGGAAGATGTGGCTGACATGAACTACTTTTCGGCAAACAACGAAGGAGAGATCTGCGTCAAGGGAAGCAGTGTGTTCAAAGGATACCTGAAGGACCCTGAGAAGACAAATGAAGCCCTGGACAAGGACAACTGGCTTCACACAGGAGACATTGGTCGCTGGCTCCCGAATGGAACTCTGAAGATCATTGATCGAAAAAAGCACATTTTCAAGCTGGCCCAAGGAGAATACATTGCTCCAGAGAAGATAGAAAATATCTACATCAGGAGTAAACCTGTGCTGCAAATTTTTGTACACGGGGAAAGCTTATGGTCATTCTTAATAGCAGTGGTGGTTCCTGACCCAGACGTACTTCCCTCATTTGCAGCCAAAATTGGGGTTAAGGGCTCTTTTGAAGAACTGTGCCAAAACCAAGTTGTAAAGGAAGCCGTTTTAGAAGACTTGCAGAAAATTGGGCAAGAAAATGGCCTTAAAACCTTTGAACAGGTCAAAGACATTTATCTTCATCCGGAGCCATTTTCCACTGAAAATGGGCTCTTGACACCAACACTGAAATCAAGGCGGGAACAGCTTGCCAAGCACTTTCAGACACAGATCAACAGCCTGTATAAGGACATCTAGGAGTAGGCTAAGGTACTGCTGGGAGGGGCTCAGTAGTATGTCTTGTGGGAATATGACTTAAAAACTAGTCTTATGTTCACTACTTGTCTTTCTGCCTGT