Transcript asmbl_62294

Sequence
Transcript Sequence for observation asmbl_62294 of TGE0006453:
CTACGACATGCCTTTCAAGAAAGAAAAGTCTTTTGAAATTGTGATTCTGGTGCTGGAAGACAAATTCCAGGTGGCCGTGAATGGGAAGCACGTCCTGCTCTACGCGCACAGGATGCGCCCGGAGGAAGTGGACACACTGGGCATTTACGGCAAAGTGCACATCCACTCTGTGGGCTTCAGCTTCAGCTCGGATTTAGGAAGTACCCAAGCATCTACTCTGGAACTGACAGAGATAAGTAAAGAAAATGTAAATAGCGGTTTCTTTTCAGACGCTGCCATTTGTCGCAAGGCTGAACTCTTCCATGGGTCCCGGACGGACTGTCGTCATCAAAGGAGAAGTGAACACAAACGCCAAAGGCTTTAATGTCGATCTACTCTCAGGAAAATCGAAGGATATTGCCCTCCACCTGAACCCACGCCTGAACGTTAAAGCATTTGTGAGAAATTCTTTTCTTCAGGAGGCCTGGGGAGAAGAAGAGAGAAATATTACCTGTTTCCCATTTAGTCCTGGGATGTATTTTGAGATGATAATTTATTGTGATGTTAAAGAATTCAAGGTTGCGATAAACGGCGTGCACAGCCTGGAGTACAAACACCGGTTCCTGGAGCTCACCAGTATCGACACGCTGGAAGTCGACGGAGACATCCACTTACTGGAAGTAAGGAGCTGGTAGCTGACGTGAATTGCCTCAAAAACTGAAATACAAAATGGCTTATGTAACACTGGCTTTGTTAAAATGCATCTCAGTATTATCATGTTTATATGTTAAATGAGCTTATAGCAGTTATACTGGGTGTTCCGTCCTAGTAGGTAGTGTGGCTC