Transcript asmbl_62293

Sequence
Transcript Sequence for observation asmbl_62293 of TGE0006453:
CTACGACATGCCTTTCAAGAAAGAAAAGTCTTTTGAAATTGTGATTCTGGTGCTGGAAGACAAATTCCAGGTGGCCGTGAATGGGAAGCACGTCCTGCTCTACGCGCACAGGATGCGCCCGGAGGAAGTGGACACACTGGGCATTTACGGCAAAGTGCACATCCACTCTGTGGGCTTCAGCTTCAGCTCGGCTTCCCAGTGCTGACAGCGGTTTCTTTTCAGACGCTGCCATTTGTCGCAAGGCTGAACTCTTCCATGGGTCCCGGACGGACTGTCGTCATCAAAGGAGAAGTGAACACAAACGCCAAAGGCTTTAATGTCGATCTACTCTCAGGAAAATCGAAGGATATTGCCCTCCACCTGAACCCACGCCTGAACGTTAAAGCATTTGTGAGAAATTCTTTTCTTCAGGAGGCCTGGGGAGAAGAAGAGAGAAATATTACCTGTTTCCCATTTAGTCCTGGGATGTATTTTGAGATGATAATTTATTGTGATGTTAAAGAATTCAAGGTTGCGATAAACGGCGTGCACAGCCTGGAGTACAAACACCGGTTCCTGGAGCTCACCAGTATCGACACGCTGGAAGTCGACGGAGACATCCACTTACTGGAAGTAAGGAGCTGGTAGCTGACGTGAATTGCCTCAAAAACTGAAATACAAAATGGCTTATGTAACACTGGCTTTGTTAAAATGCATCTCAGTATTATCATGTTTATATGTTAAATGAGCTTATAGCAGTTATACTGGGTGTTCCGTCCTAGTAGGTAGTGTGGCTC