Transcript asmbl_11260

Sequence
Transcript Sequence for observation asmbl_11260 of TGE0003585:
AGAGCCCCGGTTCCGCGCGGCCGATGTCCCAGCCGCCGGAAGTTGCCCGAGGCTCGCCGAGCGCCTCTGAGGAGCCCGGCGTCGCGCAGGCAGAGTGGCCACTGCAGTGGGTGTAGATGTGCCTGACGAGATGAAGAGCCGAATCCCTGTGGTGCTTTTGGCCTGTGGCTCCTTCAACCCCATCACCAACATGCACCTGCGCTTGTTTGAGGTGGCCAGAGACCACCTACACCAAACAGCTGTGCCTGAACTGAAGCTCCTCTGCGGGGCAGATGTCCTGAAGACCTTCCAGACCCCTGACCTCTGGAAAGACGAGCACATCCAGGAAATAGTGGAGAAGTTCGGCTTAGTGTGTGTGGGCCGGGTAGGTCACGACCCAAAGGGGTACATCTCAAGCTCCCCCATCCTTCAGAGATACCAGCACAACATTCACCTGGCCAGGGAGCCTGTGCAGAACGAGATCAGTGCCACGTACATCAGGCGGGCCTTGGGCCAAGGGCAGAGCGTGAAGTACCTGCTCCCAGACGCTGTCATCGCCTACATCAAGGACCACAACCTTTATACCAGGGGCAGTTCCTGCAAAGGCAATAACACCCAGAACAACTTAGGAAAGACAAGCTAGGGAGGGCCAAACCCTCCTCCACCAAGCTCCTCCTGAGGAGAGGGCCGTTAAGGTCTTTCCTTTTTTTCAGCTTTTTCCTTTTTCCTTTGTTCTAGTTCAACAATGATTTTACTTCTGAAGAGTCTTCTATCCCAGAAAGAGATAACTTCTTTTGGTAGGAGCTAGTATCTACACAAGAATAGACGTTTATCAAAAAAGTTCAAATGGTGTAGCAGGTCATTAGGATTGGGCGAAAGCTCTCAGAATCTCTGGGTGAAGAGACCTGCTTATTTTGTAAATGGTTGTATGCACACTGGAGGTGGTTCCACGTATGGCAGGGGCCCCTGACGGTCAGATCAGAATTGCCCACAATGCATTTTTTAACTAGGACCAGGTGCAGCATGCTGGTCATGATTAGAAAAACTGGACAGAATGCTAATTACCAAACAGTGGGCTATGTCAACGCCATGTTGAAAACGAAATAATAACCGAAGAGTCAAAAACTTGGAAGCAGCACTTTGCTGATTTACAGTGAATCTTCTGTTAAGAACCGTGCTCTGCCTGTCCCCTGGATGTTGATAAAATTTAAACTAAAATTTTTCTAAGTAGTGATCCTCCAACTATTTTTGAAACAGCAAATATTTTTAGTGCAGCTCTTCTATAAATATCAGGGCTCCTGGTTTCCAGGTTCCTGAAAAGGAACTGGGGTAAGACAGATGCCTTGACTGTCTTAGAGGATCTTTTTGAATGTTTTATGATTGCCTGCCTGTTTGAGTATTGGCAAAGGGCTAAATAATAAATAGACATCAAAAAGTA