Transcript asmbl_11209

Sequence
Transcript Sequence for observation asmbl_11209 of TGE0003583:
GGGGAAGTGGTGAGGAAGAGAAGGTCGGAGGTCGCTTCATCCCACTTTGGACGCAGAGCCGGCGGCGGGAGGAGCTCGGATTGGAGCTTCTCCAGCCTCCCGCAAGATTTCAGCACAAAATGAACATAATTAGGGAAAATAAGGATTTGGCATGTTTCTACACAACAAAACATTCATGGAGGGGAAAGTATAAGCGTGTCTTTTCAGTTGGAACCCATGCGATTACTACATATAATCCCAATACTTTAGAAGTAACAAATCAGTGGCCTTATGGAGACATTTGCAGTATCAGCCCTGTTGGAAAAGGACAAGGAACAGAGTTCAACCTCACATTTCGTAAAGGCAGTGGAAAAAAGTCAGAAACTTTAAAATTTTCTACAGAGCACAGAACAGAACTTCTTACAGAAGCATTGAGATTTAGAACTGATTTTTCAGAAGGAAAAATCACAGGAAGGAGATATAACTGCTATAAGCATCACTGGAGTGATACAAGAAAACCTGTTATCTTAGAAGTAACTCCTGGAGGCTTTGACCAAATTAATCCTGCAACCAATAGAGTCCTCTGTTCCTATGACTATAGAAATATTGAAGGATTTGTAGATCTCTCTGATTATCAAGGAGGGTTTTGTATACTTTATGGAGGATTTAGTAGATTGCATTTGTTTGCATCAGAGCAAAGAGAAGAAATTATAAAAAGTGCGATAGATCATGCTGGCAACTACATAGGTATTTCACTGCGGATCAGAAAAGAACCTTTAGAATTTGAGCAATATTTGAATCTCCGCTTTGGAAAATACAGCACTGATGAATCCATCACATCTTTAGCAGAGTTCATAGTCCAAAAAATATCTCCTAGACATTCGGAACCTGTAAAAAGAGTTCTAGCGCTTACAGAAACATGTTTAGTAGAACGGGATCCAGCAACCTATAATATTGCAACATTGAAGCCGTTAGGAGAAGTATTTGCATTGGTTTGCGACTCAGAAAATCCACAACTTTTTACCATTGAATTTATAAAAGGGCAAATACGGAAGTATTCTTCAACAGAGAGAGATTCCTTATTAGCAAGTTTGCTGGATGGAGTAAGAGCCTCTGGTAACAGAGACGTTTGTGTAAAAATGACATCAACCCATAAAGGTCAACGATGGGGGTTACTCAGCATGCCTGTAGATGAGGAAGTAGAGAGCCTTCATCTTAGATTCCTGGCTACACCTCCAAATGGCAACTTTGCAGATGCTGTATTCAGGTTCAATGCTAATATTTCATATAGCGGAGTTCTGCATGCAGTGACACAGGATGGTCTCTTCTCAGAAAACAAAGAAAAACTGATCAATAATGCCATAACGGCATTATTGTCCCAAGAGGGAGATGTTGTTGCTTCAAATGCAGAACTTGAGAGTCAGTTCCAGGCTGTGAGGAGGCTTGTGGCTTCCAAAGCTGGCTTTCTAGCCTTTACTCAGCTTCCAAAGTTTCGGGAGCGTCTGGGAGTGAAGGTAGTAAAAGCACTCAAGAGGAACAACAATGGAGTAATCCATGCAGCTGTTGATATGCTCTGTGCTCTCATGTGTCCCATGCATGATGACTATGACTTAAGACAAGAACAGCTAAACAAAGCTTCTCTTCTCTCTTCAAAGAAGTTTCTGGAAAACTTACTGGAGAAATTTAATTCCCATGTGGATCATGGGACCGGTGCCCTGGTTATTAGTTCACTCTTGGACTTCCTTACTTTTGCCCTCTGTGCTCCATATAGTGAGACAACAGAAGGGCAGCAGTTTGATATGCTCTTAGAAATGGTAGCATCCAATGGAAGAACCCTCTTTAAACTCTTTCAGCATCCTTCCATGGCAATTATAAAGGGAGCTGGATTGGTTATGAAGGCAATAATAGAGGAAGGTGACAAGGAAATTGCTACAAAAATGCAGGAGCTTGCCCTAAGTGAAGGTGCCTTACCTCGACATTTGCATACTGCGATGTTTACCATAAGCTCAGATCAAAGGATGCTTACAAATAGACAGCTAAGTAGACATTTAGTGGGACTCTGGACAGCTGATAATGCAACTGCAACAAACTTGTTGAAACGCATTTTGCCACCAGGCTTGCTGGCATACTTGGATAGCGCAGATTCAGTTCCTGAGAAGGATGCTGATCGGATGCATGTTAGAGATAATGTGAAAATAGCAATGGATCAGTATGGAAAATTTAATAAAGTTCCGGAGTGGCAAAGACTAGCTGGAAAAGCTGCTAAAGAAGTTGAAAAATTTGCCAAAGAAAAAGTGGATCTTGTGTTAATGCATTGGAGAGATAGAATGGGTATTGCACAAAAAGAGAATTTAAATCAAAAACCAGTAGTTCTCCGAAAGAGAAGACAAAGAATAAAAATAGAAGCAAATTGGGATCTCTTCTATTATAGGTTTGGTCAGGACCATGCCAGATCAAACCTAATTTGGAATTTCAAAACACGAGAAGAATTGAGAGATAGTCTTGAATCTGAA