Transcript asmbl_61831

Sequence
Transcript Sequence for observation asmbl_61831 of TGE0006435:
GAAAATTTTAAAGGAGTGATTTATACCGTTTCACTTTCGGTTTGGAACATTAATGGATTTCTGCTTTTTAAGGAGGCGGCTGTAATGGGGAACATGAAACTTTCAGTTCTCCAGTTAAAAATCGAAAACTGCTTTTTTAAAACCTTTTTTCTTTTTGATTTGATTTAAAAACTGTATCCTCGCTTATTCTGCTGTCTATAACGGAAGTTTTGTAGGTTTCGCAACGGTGGTTTCACTTTTGTTAAAACGTTAAGCGGGGTGGAGTAGACTCTCTGGAATACACGATGGCGCAAAAGAAATATCTCCAAGCAAAATTGACCCAGTTTTTAAGGGAAGACAGAATTCAACTTTGGAAACCTCCATATACAGATGAAAATAAAGAAGTTAATTTGGCATTGAAGGACCTCGCTAAGAAGTACTCCGACAAGCTAGAATGTTGCGAAAATGAAGTAGAAAAAGTCATAGAAGAGATTCGTCGCAAAGCAATCGAGCGGGGCACAGGAAATGAAAATTACAAGACGACAGGGATCGCTACAATTGAGGTATTTTTACCTCCACGACTAAGGAAAGATAGGAAAACCCTGTTGGAGACCCGACTGCACATCACTGGCAAAGAACTGAGGTCTAAAATAGCTGAAACCTTTGGATTTCAAGAAAATTATATCAAAATTGTCATAAATAAGAAACAACTTCAACTAGGCAAATCGCTCGAGGAGCAGGGAGTGAAGCACAATGTGAAGGCCATGGTGCTGGAGCTGAAACAGTCCGAGGAGGACGCAAGGAAGAACTTCCAGGACGAAGAAGAAGAGCAGAATGAAGCCAAGCAGAAGGAGAAGCGAATTCAGAGGACCAAGAGAGGGCTGGAGATACTGGCGGAGAGAGCTGAGATGGTGGTGGATCCGGAAACTACACCGTACCTGGATATCGCCAACCAGACGGGCAGATCCATCGAGATCCCGTCGTCGGAAAGAAAAGCCCTTATGTTAGCGATGGGTTATCACGAGAAGGGCAGAGCGTTCCTGAAGAGGAAAGAATATGGAATAGCCTTGCCGTGTCTGCTGGACGCTGACAGATATTTCTGCGAGTGTTGCACAGAACTTCTGGATACAGTGGATAACTACGCGGTCCTCCAGCTGGATATAGTGTGGTGCTACTTCCGCTTGGAACAACTGGAATGCCTTGACGACGCAGAAAAAAAATTAAACTTGGCCCAGAAATGCTTTAAGAATTGTTATGGAGAAAATCATCAGAGACTGGTCAACATTAAAGGAAATTGTGGGAAAGAGAAGGTATTGTTTTTAAGACTTTACCTGCTTCAAGGTATCCGAAATTTTCACAGTGGGAATGGTGAAGAGGCTTCTGAGTATCTCAACAAGGCACGTCAGCTCTTTAAAGAGCTATACATCGATCCATCGAAAGTTCACAGTTTGTTGCAGTTGGGGTTTACCGCCCAGGAAGCCCGGCTTGGCCTCAGGGCCTGTGACGGGAACGTGGACCACGCAGCCACCCACATCACCAGCCGCAGAGAGGAATTGGCCCAAATAAGGAAGGAGGAAAAAGAGAAGAAGAGACTCTGCCTGGAGAACGTAAATGCCCTGAAGGGCATGGGCTACTCCACGCACGCGGCCAGGCAGGCCCTGCAGCAGGCCCGCGGGAACCTGGACGAGGCCCTGCGGATTCTTCTCAGCACCCCTCGGATGTGGTTCAGTGATTCCGACTCGGAAACCAGCAACCATCAAGAAAGTCCTTCCCAGGAAAATATCGACCAACTGGTGTACATGGGCTTCGACACGGCGGCCGCCAGGGCCGCCCTGCGGGTGTTCCGGGGGAACGTGCAGCTGGCCGCGCAGACCCTCGCGCACAACGGGGGAAGTCTCCCGCCCGGCCTGCAGCTCGCGGTGGAGGAGCCTCCGTCGACGCCCTCCACGTCCCCTTCCGACTCTGCAGGTACCTCTAGTGCCTCAACAGATGAAGATATGGAGACAGAGGCCGTCAATGAAATACTGGAAGATATTCCAGAGCACGAAGAAGATTATCTCGACTCGACTCTGGAAGACGAAGAAATTATTATTGCAGAGTACTTATCCTACGTAGAAAATATAAAGTCAGCATCAAAGAAAAACTAAATAATGAACAGAAATAAGTACTAAGTTTCTGCTTATAAATTCTATCGTTATGAAAAGTGTAATGCAGGTCTTCCTTTTTTTTCTTCTTTTCATCTGATTTTGCTCTGGAGTGCTTTCACCTTGGGTGTAG