Transcript asmbl_61816

Sequence
Transcript Sequence for observation asmbl_61816 of TGE0006434:
CGCCTGGCCGCCCTCTCGCCGCGTCGCCGGTCCCTGAGCCGCCCGCACCTCCTCGCCTCTCCTCTCCCGGCCGAAGCCCGGGGGACCAGAGCGAGAAGCGGGGACTATGTTCCGACGCAAGCTGACGGCCCTCGACTACCACAACCCTGCCGGCTTCAACTATAAAGATGAAACAGAATTTAGAAACTTTATTGTTTGGCTTGAAGACCAGAAAATCAGACACTACAAGATTGAAGACAGAGGTAATTTAAGAAACATCCACAGCAGTGACTGGCCCAAGTTCTTTGAAAAGTATCTCAGAGATGTTAATTGTCCTTTCAAGATTCAAGATCGACAAGAAGCAATTGACTGGCTTCTTGGTTTAGCTGTTAGACTTGAATATGGAGATAATGCTGAAAAATATAAGGACTTGGTACCTGATAATACTAAAAATGCTGACAAAGCAGCTAAAAATGCAGAGCCACTGATCAATTTGGATGTAAATAATCCTGATTTTAAGGCTGGTGTCATGGCTTTGGCTAACCTTCTTCAGATTCAGCGTCATGATGATTACCTGGTGATGCTTAAGGCAATTCGCATTTTGGTCCAGGAGCGCCTGACACAGGATGCAGTTGCTAAAGCAAATCAAACAAAAGAGGGCTTGCCTGTTGCTTTAGACAAGCATATTCTTGGTTTTGACACAGGAGATGCAGTTCTTAATGAAGCTGCTCAAATTCTGCGATTGCTGCACATAGAAGAGCTCAGAGAGCTACAGACAAAAATTAATGAAGCCATAGTAGCTGTTCAGGCAATTATTGCTGATCCAAAGACAGACCACAGACTGGGGAAAGTTGGAAGATGAACATTTTAGGATGTTAGCCGCTCACCTACTTAGTACAGTTGGGAACCATGTATGCTGTGGCATGTGTTTGGGAATCAAATGTCAATTTTCAAGGAAAGGATCCCAGAAAATTGACTATGTTCTAGAGATTTATCATCATTGCTTTTTCTTTAATAAAGTTCAGGAATGTA