Transcript asmbl_11208

Sequence
Transcript Sequence for observation asmbl_11208 of TGE0003582:
GGGGAAGTGGTGAGGAAGAGAAGGTCGGAGGTCGCTTCATCCCACTTTGGACGCAGAGCCGGCGGCGGGAGGAGCTCGGATTGGAGCTTCTCCAGCCTCCCGCAAGATTTCAGCACAAAATGAACATAATTAGGGAAAATAAGGATTTGGCATGTTTCTACACAACAAAACATTCATGGAGGGGAAAGTATAAGCGTGTCTTTTCAGTTGGAACCCATGCGATTACTACATATAATCCCAATACTTTAGAAGTAACAAATCAGTGGCCTTATGGAGACATTTGCAGTATCAGCCCTGTTGGAAAAGGACAAGGAACAGAGTTCAACCTCACATTTCGTAAAGGCAGTGGAAAAAAGTCAGAAACTTTAAAATTTTCTACAGAGCACAGAACAGAACTTCTTACAGAAGCATTGAGATTTAGAACTGATTTTTCAGAAGGAAAAATCACAGGAAGGAGATATAACTGCTATAAGCATCACTGGAGTGATACAAGAAAACCTGTTATCTTAGAAGTAACTCCTGGAGGCTTTGACCAAATTAATCCTGCAACCAATAGAGTCCTCTGTTCCTATGACTATAGAAATATTGAAGGATTTGTAGATCTCTCTGATTATCAAGGAGGGTTTTGTATACTTTATGGAGGATTTAGTAGATTGCATTTGTTTGCATCAGAGCAAAGAGAAGAAATTATAAAAAGTGCGATAGATCATGCTGGCAACTACATAGGTATTTCACTGCGGATCAGAAAAGAACCTTTAGAATTTGAGCAATATTTGAATCTCCGCTTTGGAAAATACAGCACTGATGAATCCATCACATCTTTAGCAGAGTTCATAGTCCAAAAAATATCTCCTAGACATTCGGAACCTGTAAAAAGAGTTCTAGCGCTTACAGAAACATGTTTAGTAGAACGGGATCCAGCAACCTATAATATTGCAACATTGAAGCCGTTAGGAGAAGTATTTGCATTGGTTTGCGACTCAGAAAATCCACAACTTTTTACCATTGAATTTATAAAAGGGCAAATACGGAAGTATTCTTCAACAGAGAGAGATTCCTTATTAGCAAGTTTGCTGGATGGAGTAAGAGCCTCTGGTAACAGAGACGTTTGTGTAAAAATGACATCAACCCATAAAGGTCAACGATGGGGGTTACTCAGCATGCCTGTAGATGAGGAAGTAGAGAGCCTTCATCTTAGATTCCTGGCTACACCTCCAAATGGCAACTTTGCAGATGCTGTATTCAGGTTCAATGCTAATATTTCATATAGCGGAGTTCTGCATGCAGTGACACAGGATGGTCTCTTCTCAGAAAACAAAGAAAAACTGATCAATAATGCCATAACGGCATTATTGTCCCAAGAGGGAGATGTTGTTGCTTCAAATGCAGAACTTGAGAGTCAGTTCCAGGCTGTGAGGAGGCTTGTGGCTTCCAAAGCTGGCTTTCTAGCCTTTACTCAGCTTCCAAAGTTTCGGGAGCGTCTGGGAGTGAAGGTAGTAAAAGCACTCAAGAGGAACAACAATGGAGTAATCCATGCAGCTGTTGATATGCTCTGTGCTCTCATGTGTCCCATGCATGATGACTATGACTTAAGACAAGAACAGCTAAACAAAGCTTCTCTTCTCTCTTCAAAGAAGTTTCTGGAAAACTTACTGGAGAAATTTAATTCCCATGTGGATCATGGGACCGGTGCCCTGGTTATTAGTTCACTCTTGGACTTCCTTACTTTTGCCCTCTGTGCTCCATATAGTGAGACAACAGAAGGGCAGCAGTTTGATATGCTCTTAGAAATGGTAGCATCCAATGGAAGAACCCTCTTTAAACTCTTTCAGCATCCTTCCATGGCAATTATAAAGGGAGCTGGATTGGTTATGAAGGCAATAATAGAGGAAGGTGACAAGGAAATTGCTACAAAAATGCAGGAGCTTGCCCTAAGTGAAGGTGCCTTACCTCGACATTTGCATACTGCGATGTTTACCATAAGCTCAGATCAAAGGATGCTTACAAATAGACAGCTAAGTAGACATTTAGTGGGACTCTGGACAGCTGATAATGCAACTGCAACAAACTTGTTGAAACGCATTTTGCCACCAGGCTTGCTGGCATACTTGGATAGCGCAGATTCAGTTCCTGAGAAGGATGCTGATCGGATGCATGTTAGAGATAATGTGAAAATAGCAATGGATCAGTATGGAAAATTTAATAAAGTTCCGGAGTGGCAAAGACTAGCTGGAAAAGCTGCTAAAGAAGTTGAAAAATTTGCCAAAGAAAAAGTGGATCTTGTGTTAATGCATTGGAGAGATAGAATGGGTATTGCACAAAAAGAGGACAGAAACAATATGAATTTAAATCAAAAACCAGTAGTTCTCCGAAAGAGAAGACAAAGAATAAAAATAGAAGCAAATTGGGATCTCTTCTATTATAGGTTTGGTCAGGACCATGCCAGATCAAACCTAATTTGGAATTTCAAAACACGAGAAGAATTGAGAGATAGTCTTGAATCTGAA