Transcript asmbl_61726

Sequence
Transcript Sequence for observation asmbl_61726 of TGE0006414:
GAGCCGACGTCGCCTCCTGCGCTGGGCTCAGCCTCGCTTCTAATTGGCCACCTTCGGGGCCGCCCTCCTGCGCGCACCAGCCCTGGGTTCCCTCCGCGGTCCGCACTGGTAAAGCTATCCTCTTCCTTCTTGACCCCTGGCGGTTCCTCCCTCCCTTCCTTCCCTCCCGCTGCCGCCGTCGCTTCTGGCACCACTGCTCCCGGAGGAGCCTTCCGGCTGGGTGATGGGGTCTCGGGCCTCCACGTTACTGCGGGATGAAGAGCTCGAAGAGATCAAGAAGGAGACTGGCTTTTCCCACAGTCAGATCACCCGCCTCTACAGCCGGTTCACTAGCCTGGACAAAGGAGAGAACGGGACTCTCAGCCGGGAAGATTTCCAGCGGATTCCAGAACTTGCTATCAACCCATTGGGGGATCGGATCATCAATGCCTTCTTTCCAGAGGGAGAGGACCAGGTAAACTTCCGTGGATTCATGAGAACTCTGGCTCATTTTCGGCCCATTGAGGATAATGAAAAGAGTAAAGATGTGAATGGACCAGAACCACTCAACAGTCGAAGCAACAAACTACACTTTGCTTTTCGACTATATGATTTGGATAAAGACGACAAGATTTCCCGTGATGAGCTGTTACAGGTCCTACGCATGATGGTCGGAGTGAATATCTCAGATGAACAGCTGGGCAGTATTGCAGACAGGACCATCCAGGAGGCTGATCAGGATGGAGACAGTGCCATATCTTTTACAGAATTTGTTAAGGTTTTGGAGAAGGTGGACGTAGAACAGAAAATGAGCATCCGGTTTCTTCACTAAAGGACTGAGATCAAACTGTTTCGTGCTTTCTAGTATTTAAGAACTGGAACCTGAGAATCCTCCTGTCCACCAACCCCACCTCCATTCCATCATTCCCCTTCTCCCTAAGTACCAAGGCTGTTGCATGATAACTCAGATATGTTCTATCAACACAAACCTGCCTTTGGTGTATAAACAGGGCATTATAGAATGGTACACCTGGTCTATATCTGTTCAGTATCATTCACTGGTTATCTCCATTTCTAAATATTCCTAACCCTTCCCCCACCCCGGTTCTGCTACTGAATGCCTCATGTCCATCTAGTCTGAGAAAGTGAGAGAAGGAATTATGCCAAGAACTAACCAGCAAAGCTCTTTCACTGGATGTAGACTATAGCCATGCCACCGTCCCTCCAGCTAGGCTTTGGCATGCTCCTCCATCCTTTTTTGTATGTCCTTTGCTTCCTACTTCTCTTTCACCCAATACACCATTCACTTAGTCTTTGTCTCTCTGCTTTTTATTAAGCTTCAGCCCCCTCTGTTCTATTTGGCACTCCAAGCTATGCCTGTTCAATGAATTTCTGACTTGGCAGGATAGTTTGGTGGTCTGAAGGATTTTAATCTACTGTTACTCTTGAATGGTCTCTGGGATGTTGCCTTTCCAGGAGCTTTTCGATAACAACACTGCTCTCAGAAGAATGAGACCATCTCTTGGTCCCTTGCACTCTGCTGTGTCATCAAAAGGCCGTGGGCTAGAGATGTTCTTCTTGAAAGGTGGTGGCCTTGTTGAGAGATGTAGAGCCAAGTCTTTTCGGTGGCTTGCCCAGATCGCTCTACCTCTGGCTTCTGATTCTCAACATACATACCTACATGGCTACTTTTAATAGTACAGTGTTGTTTTTTCAGAAAATAGCCACATGCTGGCAGGTTGGCTTAGTTTGGGGACACCAATACCACCAGAATGGCTGCCCTGACAGTATGCTTGGGGACTTTCTCGTGGCTTTTTGAACAAGAAGGCTGGGCACCCTAAAAGCCTCACGTATTCCCACCTCTGCAGCATGGTTTATACCTCAGTGTTATGTGCCCTGGAATGTTTCTCACTTCACATTTCTAGGTAGAAAGATTAGTGTTATGGAAGTGCCTAACTATCCCAGTCCAAAAGATTTAAAGATTGTCCTCAGTGTCTTGAAGTTTTGTACAAAATTCTCTATGAATTTTACATTTGGCAAATGTTAATGCTGGAAGCCATAGTCAGCCCTTAATACAGGTCCAAAGCATTGAATGTATTGTATCATTAGCTGCCTAGTTACACTGACTTCCTAGCTCCTCTCAGACCACTGCTAATCCCTTAGAAACGAGGGGTCTGGCATTGGTAGCATAACCTGAGGTGGCATTACAGGCCTTTGCACGAGCCAGAGCAACTTCTCTGCCTAAGTCAGCTAAATGTAGACCTCATTGAATCAGGCTGTTGTCCTAATGTTGGTCATTTATGAGTCTGTTCATTCTTATATCTGCCCTTAGCTGATTTTCTGACTCATTGCTTGCTGGCTTGTTTCCTTGCTTTGGAAGGCTATCCAAGATGTATACACAATACTTTCAGAAGGGAACTGCTAAAACAAAAAACACCACAAAGGGATTGGAAAGAGGGGAACAGAGCAGTAGTCAGGCTAGATAACTTAAGTATAAATGACTGAGGAATTCTTGATGAAGTATCAGTCTGACTTTGTGATCAAATGATATAATATAGGAATTGTGTAAAGGGAAGAATAATCTGACATTGATTTGTTAGAGAAGTACTTCAAAGGCTCCTTGACTTGCATATTTAAAATTCCTAAGATTATGGCTTTTTCTTCCCTTTGGCTGTATAGCAAACTGTTTTAATCCACAGTTGTGCCTTATCGTTCCATTAAAACTGTATTCTATCCATCAATAAACACTTGTGG