Transcript asmbl_61648

Sequence
Transcript Sequence for observation asmbl_61648 of TGE0006406:
GGCCCCCGCCCGCAGAGTTCTGATTGGCTGTGCACGCGTGGAATATAAGCCCAGACGCGCGGCCAGGAGTGCAGTAGGACGCTCGGAGCTGCTCTGGTAGCGATGGCTCTCCCCGTGACCTTGGCCCTGTTCGCGCTGCTTTTCCTTTCTGGCCTAGACGGCGAGCCGCGTACTCCAAAGATTCAGGTTTACTCACGGCATCCAGCAGAGAATGGAAAGCCAAATTACCTGAACTGCTATGTCTATGGATTCCACCCACCTCAGATTGAAATTGATTTGCTGAAGAATGGACAGAAGATGAAAACGGAGCAGTCAGACTTGTCTTTCAGCAAGGACTGGTCGTTCTATCTTCTGGTCCACACAGATTTCACTCCCAGTACAGTGGATGAGTACAGCTGCCGTGTGAATCACAGCAGTCTCGCTGCGCCCCATATGGTTAAGTGGGATCGAAACAACTAACCAGCATCATGGAGGTTTGAAGATGCCTCATTTAAATTGGACTAATTCCAAATTGTTTCTTCTTTTTTTTTTAAATACTTATATGCTAGTATGCTTTATGTACACAAATTGAGAAGATATATTGATGTTAACATAAATACCTTTATAATTCTACTTTGGGCTCTATGTCTTCATATTTGATGCATGTGGGTAGGTAGCTGTAGCAGGTTGCTAGAAGTTTAGAGGTGGGAAGGAGGGAATTCTCATGTTCAATATCATCATCTTGGTCTAATCTGAACTCTTTAGTATTCTGCATACAAAATTGGATAAGATCATTGTGCATGTTTAGAGTTAAGCTCCAGTTTGCATACTTTGCTTAGAATTTTTGGAAATAGTTTTTAAAAGAAAATTGTCAATTATTGGAAAATCATTATAGTGGATTGAAAGAATTTTCATATAAAATTCACATTTACCTCATATTTGTGTGGCACATATGTTGCAGGCGAGAATTCTGTCAGAGAACCACCAGTACGCCAGTTGTATTGCACATATTTTGATATTTTTGCTTCACTGATTAAAATAATGGTAAACTTG