Transcript asmbl_61634

Sequence
Transcript Sequence for observation asmbl_61634 of TGE0006402:
GAAAGGACTCCTGCTGCAGATGTCTTGTGATTACCTCGGAAGCCTTACTTCGCCAGTTGAAACTGCAGAAGAAAATAGGATCTAGCGAAATATGGCTACGGAGGGCCCTGCCACGTGTCGAATCCAGGTGGCAGAACATCCCAGATTGCTAAAGCTAAAAGAGACATTTAACTCTAAGTTTGGATCCATTCCCAAGTTTTATGTTCGAGCACCAGGAAGAGTCAACATAATAGGAGAACATATAGATTACTGTGGATATTCTGTTCTTCCTATGGCTGTGGAACAAGATATGTTAATAGCTGTGGAACCTGTGAAAACACACACTCTTCAACTGGCCAATACAAATCCCTTGTACCCAGATTTCAGTACTAGTGCTAATAACATTCAGATTGACAAAACCAAGCCTCTGTGGCACAACTATTTCCTATGTGGATTTAAAGGAATTCAGGAACACTTTGGTCTTAGTAACCTGACTGGAATGAATTGCTTGGTGGATGGAACCATCCCACCAAGTTCTGGCCTCTCCAGCTCCAGTGCTTTGGTCTGTTGTGCTGGCTTGGTGACGCTCACAGTTTTGGGAATGAACCTATCCAAGGTGGAACTTGCAGAAATCTGCGCCAAGAGTGAGCGTTATATTGGCACCGAAGGAGGAGGGATGGACCAGTCCATATCATTTCTTGCAGAAGAAGGAACGGCCAAGTTGATAGAATTTAGTCCTCTGAGGGCAACGGATGTGAAACTCCCAAGTGAAGCAGTGTTTGTGATTGCCAACAGTTGTGTGGAAATGAATAAGGCAGCAACTTCCCATTTCAACATCAGGGTGATGGAGTGCCGGCTGGCTGCAAAGCTCCTGGCTAAGTACAAAAGCTTGCAATGGGATAAAGTACTGCGGCTGGAGGAGGTACAGGCCAAACTAGGGGTCAGCCTGGAAGAAATGCTGTTAATCACAGAGGATGCTCTTCACCCTGAACCCTATAGCCCCGAAGAGGTCTGCAAGTGTCTGGGAATTAGCCTGCAGGAACTCCGGACCCAAATCCTGAGTCCGAACACACAAGATGTGCTCATCTTCAAACTCTACCAGCGGGCAAAGCACGTGTACAGTGAGGCTGCGCGAGTACTCCAATTTAAGAGGATATGTGAAGAGGCACCTGGCAACATGGTCCAGCTGCTGGGGGAGCTAATGAACCAGAGCCATGTGAGCTGCCGGGACATGTACGAGTGTAGCTGCCCTGAGCTGGACCAGCTG