Transcript asmbl_11195

Sequence
Transcript Sequence for observation asmbl_11195 of TGE0003577:
TCTAATTTGGCATTACTCGGTCTCAGCCTGTAGAAGTCACATGGCAACACTGAGGTAGACATTTAGTTGTGGACTTAACCATTGACTTATTCATTCGGCTTTTCCTGCTTGCTTTTAAAGTAACAGCTCTCGTGAGGGAACCCAGTGGAAGTAACTGTCTGATGGGCGCGTTTGTCCTCCAAACTAGTCGACCTCAGGATCAAGCAAGAACTTCTGCTAGGAAACGAGTCCATACTTTAGGATGAAGATGAGTGGAAAGAATTTGAGCAAAAAGAGGTTGATTACAGCGGCCTCAGGGTCCAGGCAATGCAAATAAGTGAAAAGGAAGAAGACGATAATGAAAAAAGAGAAGATCCAGGCGATAATTGGGAAGAAGGTGGAGGTGGTGGTGGCGGCGGTGGTGTAGAAAAATCTTCAGGTCCCTGGAATAAAACAGCTCCGGTACAAGCACCTCCTGCTCCAGTAATTGTTACAGAAACCCCAGAACCGGCAATGACTAGTGGTGTGTATAGGCCTCCTGGAGCCAGATTAACTACAACAAGGAAAACACCGCAAGGACCACCAGAAATATATAGTGACACACAGTTCCCATCCCTGCAGTCCACTGCCAAGCATGTAGAAAGCCGAAAGGATAAAGAAATGGAGAAGAGCTTTGAAGTAGTAAGACACAAAACTAGAGGTAGGGATGAGGTTTCAAAAAACCAGGCACTTAAACTTCAGCTAGACAACCAGTATGCTGTACTCGAAAATCAGAAAAGCAGCCACACACAGTACAATTAAGGAATGGTCTTTCCTAACCCTTATAAGGTAACTAGACCACAGCTAAGCACCATGAACAGCCATTCGTCATCTGATCTCTGCTTGGATCTACAGCAACCGATGCAGACCACTCGGTATAAGTGACCGGCCCTATTGCACTATGGAAGTTTAAAGTGTCAGAGCTGCTCTTTATATTGAATTTAGGGGGCTTTTCATTGTTATAAATGTGAAGTAGG