Transcript asmbl_61457

Sequence
Transcript Sequence for observation asmbl_61457 of TGE0006369:
GAAAGAGCAGCCAATGAGAGAGCCTATTACTAGTTTGCGTGCTGTGGTGTAGGGGGTGCGCTTAAGGCCCTGAAGCGCTACGCGTTCTGCTGGTTTTATCAGCATGAGCTCAATCGGTACCGGGTATGACCTGTCAGCTTCCACATTCTCTCCTGATGGAAGAGTTTTTCAAGTTGAGTATGCGATGAAAGCTGTGGAAAATAGTAGTACAGCTATTGGAATCAGATGTAAAGACGGTGTTGTCTTTGGGGTAGAAAAATTAGTCCTTTCTAAACTTTATGAAGAAGGTTCCAACAAACGACTTTTTAATGTTGATCGGCATGTTGGAATGGCAGTAGCAGGTTTGCTGGCAGATGCTCGTTCTTTAGCTGACATTGCAAGAGAAGAAGCTTCCAACTTCAGATCTAACTTTGGCTATAACATTCCACTAAAACATCTTGCAGACAGAGTGGCCATGTATGTACATGCATATACACTCTACAGTGCTGTTAGACCTTTTGGCTGCAGTTTCATGTTAGGATCTTACAGTGTGAATGACGGTGCACAACTCTACATGATTGACCCATCAGGTGTTTCATATGGTTATTGGGGCTGTGCTATCGGCAAAGCCAGGCAAGCTGCAAAGACAGAAATAGAAAAGCTTCAGATGAAAGAAATGACCTGCCGTGATGTTGTTAAAGAAGTTGCAAAAATAATTTACATAGTACACGATGAAGTTAAGGATAAAGCTTTTGAACTAGAGCTCAGCTGGGTTGGAGAAATAACTAAAGGAAGACATGAAATTGTTCCAAAAGATATAAGGGAAGAAGCTGAAAAATACGCTAAGGAATCTTTGAAGGAAGAAGATGAATCAGATGATGACAATATGTAACACTTCTGCAGCTGTTTTAAATTTCTATTATAGTTCCCATGTAACTATTTAGCCCTGTGGATTATTACATACCTACTGACCAATTTTCATTAAAATTTTGTCTTGTAATGACTTAA