Transcript asmbl_61215

Sequence
Transcript Sequence for observation asmbl_61215 of TGE0006368:
GGAGGAGGGAGATAGAGAAGAGGGAAGGAAAACGGGGAAGGGAGGAAGGAAACGAGCGAGGGGGAGGGAGGTCCCTGTTTTGGCGGAGCTGAGAGCGTTGCCGTCCTCTGAAGTGGAGCGAGAGGGAGGTGCTTTGCCGTTTCTCCTGCCGGGGGTCCCGGCTTCCCGTGGAGGCTCCGGATCAAACCCCTTCAGCTTCTCCCTCCGGATCGATGTGCTGCTGTTAACCCGTGAGGAGGCGGCGGCAGCGGAAGATGGTGTTGCTGAGAGTGTTAATTCTGCTCCTCTCCTGGGCGGCGGGGCTGGGAGGTCAGTATGGAAATCCTTTAACTAAATACATTAGACATTATGAAGGATTATCTTATGATGTGGATTCATTTCACCAAAAACACCAGCGTGCCAAAAGAGCAGTCTCACATGAGGACCAGTTTTTACGTCTAGATTTTCATGCTCATGGAAGACATTTCAACCTACGAATGAAGAGGGACACTTCCCTTTTTAGTGATGAATTTAAAGTAGAAACATCAAATACAGTACTTGATTATGATACCTCTCATATTTACACTGGACATATTTATGGTGAAGAAGGAAGTTTTAGCCATGGGTCTGTTATTGATGGAAGATTTGAAGGATTCATCCAGACTCATGGTGGCACATTTTATGTTGAGCCAGCAGAGAGATATATTAAAGACCGAAGTCTGCCTTTTCACTCTGTCATTTATCATGAAGATGATATAAACTATCCCCATAAATATGGTCCACAGGGGGGCTGTGCAGATCATTCAGTATTTGAAAGGATGAGGAAATACCAGATGACTGGTGTAGAGGAAGTAACACAGAAACATAAAGAAGAACATGCCGTTAATGGTCCAGAACTTTTGAGGAAAAAACGTACAACTTCAGCTGAAAAAAATACTTGTCAGCTTTATATTCAGACTGATCATCTGTTCTTTAAATATTATGGAACACGAGAAGCTGTGATTGCCCAGATATCCAGTCATGTTAAAGCGATCGATACAATTTATCAGACCACAGACTTCTCCGGAATCCGTAATATCAGTTTCATGGTGAAACGCATAAGAATCAATACAACTACTGATGAGAAGGACCCAACAAATCCTTTCCGTTTTCCAAATATCGGTGTGGAGAAGTTTCTGGAATTGAATTCTGAACAGAATCATGATGACTACTGTTTGGCCTATGTCTTCACCGACCGAGATTTTGATGATGGCGTTCTTGGTCTGGCTTGGGTTGGAGCACCTTCAGGAAGCTCTGGAGGAATATGTGAAAAAAGTAAGCTCTATTCAGATGGTAAGAAGAAGTCCTTAAACACTGGAATTATTACTGTGCAGAACTATGGGTCTCATGTACCCCCCAAAGTCTCTCACATTACTTTTGCTCATGAGGTTGGACATAACTTTGGATCTCCACATGATTCTGGAACAGAGTGCACTCCAGGAGAATCTAAGAATTTAGGGCAAAAAGAAAATGGCAATTACATCATGTATGCAAGAGCAACATCTGGGGACAAACTTAACAACAATAAATTCTCACTCTGTAGTATAAGAAATATAAGCCAAGTTCTTGAGAAGAAGAGAAACAACTGCTTTGTTGAATCTGGCCAACCTATTTGTGGAAATGGAATGGTAGAGCAAGGTGAAGAATGTGATTGTGGCTATAGTGACCAGTGTAAAGATGAGTGCTGCTATGATGCGAATCAGCCAGAGGGGAAAAAATGCAAGCTGAAACCCGGAAAACAGTGCAGTCCAAGTCAAGGTCCCTGTTGTACAGCACAGTGTGCATTCAAGTCAAAAACTGAAAAGTGTCGGGATGATTCAGACTGTGCAAAGGAAGGAATATGTAATGGCATTACAGCTCTCTGCCCAGCATCTGACCCTAAACCAAATTTTACAGACTGTAATAGACATACACAAGTGTGCATTAATGGACAATGTGCAGGTTCTATCTGTGAAAAATATGGCTTGGAGGAGTGTACTTGTGCCAGTTCTGATGGCAAAGATGATAAGGAATTATGCCATGTCTGCTGTATGAAGAAGATGGACCTATCAACTTGTGCCAGTACAGGGTCTGTGCAGTGGAGCAAGCAATTCATGGGTCGAACCATCACACTACAACCTGGATCCCCGTGCAATGATTTTAGAGGCTACTGTGATGTTTTCATGCGTTGCAGATTAGTAGATGCTGATGGTCCTCTAGCTAGGCTTAAAAAAGCAATTTTTAGTCCAGAGCTCTATGAAAACATTGCTGAATGGATTGTGGTTAATTGGTGGGCAGTATTACTTATGGGAATTGCCCTGATCATGTTAATGGCTGGATTTATTAAGATATGCAGTGTTCATACTCCAAGTAGTAATCCAAAGTTGCCTCCTCCTAAACCTCTTCCAGGCACTTTAAAGAGGAGGAGACCGCCACAGCCCATTCAGCAACCCCAGCGTCAGAGGCCCCGGGAGAGTTATCAAATGGGACACATGAGACGTTAACTGCAGCTTTTGCCTTGGTTCTTCCTAGTGCCTACAATGGGAAAACTTCACTCCAAAGAGACACCTATTAAATCATCCCCAAACTAAACCCTTACAACTAACAGAAGAAAAAAAAAATGGCAAGAGATCATGTCCTCAGACCAGGTGGAATTAATTAAATTTTAAAGCCTGAAAATTCCAATTTGGGGGTGGGGGGTGGAAAGGAACCCAGTTTTCTTATGGACAGATATTTTTAACCTAATGGCACAAAGTCTTAGGATATTATTATGTGCCCCGTGTTCCCTGTTCTTCGTTGCTGCATTTTCTTCACTTGCAGGCAAACTTGGCTCTGGATAAACTTTTATCACAAATTGAAATATATATATATTTTTTTCAACTGCCAGTCAAGGCTAGGAGGCTCAACCACCTCAGCATTGGAGACATCACTTGCCAATGTACATACCTTGTTATATGCAGACATGTATTTCTTACGTACACTGTACTTCTGTGTGCAATTGTAAACAGAAATTGCAATATGGATGTTCCTTTGTATTATAAAATTTTTCTGCTCTTAATGAAAAATTACTGTTTAATTGACATACTCAGGATAACAGAGAATGGTGGTATTCAGTGGTCCAGGATTCTGTAATGCTTTACACAGGCAGTTTTGAAATGAGAATCAATTTACCTTTTTCTTATGATGGAATTGGTTCTGATATTCATTTTGTCTTTATCAAATGGCTGCTAAGAGCACATGAGTGACTTCGCTGAAGAACACAAGTGTTGTGCAAACTGGACATATGCAGCATACTACTTCAGAGTTAGTTCTTTATGTAAGTGTCTGATTTCTGCTTACTTGTTTTAGACTTTCTAACTCAATTCCAGTTTTGAATTGATAGGTAAAATTTTATTCATGCTTTGGTAGAAATTATGTCAATGAAATGATTCTTTTTATTTGTAACCTCTTATTTGTTTTTTCCATATATCTAAAGTATGCTAATTATGTTTTTGGTTTTTGTGTGATATGGAAAAGAAAAGCTGTGTCTTTATTTTATCAAAATATTTGAACATTTTTTTCAGCATATCATCACTGATCATTGTTAACCACTAAAGAGTGATTTGCTCTACTTGTAGTTAAAATTGTAGGATAGGCCTTCTGACCTTTTTTCCCCTGAAATATTTTAACAACAATGGAGTTGAAACAGCACAATGTCCCATTCCAAATTTATTTTGTAAACAGATGTAAATAATTGGCTTTTTAAAGAAAGAAAGCAAAAGCATTTAATGTATTAACAGGCTTATTGCTATGCAGGAATGGAAGGGGGCATTACAAGAAAATTTTAAGCTTGTGACATATTTATTACTTGTTTTCCAGCTACATCACTTAAATGAGATGTAAACAGCTATGATTTTCCTGGCTTCACATAGGAGGCAAATTTAGGGAAAGTTGAAAAAAAGTCTGTGTTTTGGCTTCTTTTTTTCCTTTTTTTTCTTAAGAGTATAAGGTTTACACAATCATTCTCATAATGTGACGCAAGCCAGCAAGGCCAAAAATGCTAGAGAAAATAATGGGATCTCTTCCTTGTAAACTTGTACAGTATGTGGTGACTTTTTTCAGAATACAGCTTTTTGTACATGATTTAGAGACAAATTTTGTACATGAAACCCCAGATAGACTATAAATAATTCTAAACAAACAAGTAGGTAGATATGTATGTAATTGCTTTTAAATCATTTAAATGCCTTTGTTTTTGGACTGTGCAAAGGTTGGAAGTGGATTTGCATTTCTAAAATGGTGACTTTTATTCTGCAAGAGTTCTTAGTAACTTCTTGAGTGTGGTAGACTTTGGAACATGTACATTTTTTGCTTGTAATGTTATCCTGTGGTAGGGTTTTGGCAGGTACACACTGCCCTATTTTATTTTGAGTCTAAGTTAAATGTTTTCTGAAAAGAGATACGTGCACTGAACTCTCCACGGCAAATCAAGATGTGGTAAAACAAAAGGATCAAGACAAATGAGATCTAATACTACTGTCAGTTTAATGTCCACTGTGTTTTATACAGTATCTTTTTGTTCACTTTGGAAATTTTTACTAAAAATTGCAAAAAATAAAGTATTGTGCAAAGATGTAAGGTTTTTTGAAACTTGAAATGCATTAATAAATAGACTTGATGAAA