Transcript asmbl_59882

Sequence
Transcript Sequence for observation asmbl_59882 of TGE0006305:
AGGTTATCCTGAATACCACATGTCTAATACTTTCCCTTGCAACGTTAGCCAGTGTTTTTCACTGCCTCCAAAAGATTGAAATTGCTCTGGAAATTGGAAACATTTGATTTAAACGAAATAACGTTAACAAATGGACAATATGTCTATTACAAATACACCAACAAGTAATGATGCCTGTCTGAGCATTGTACATAGTTTGATGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATTGAAAGTTTGGTGAAGAAACTGAAGGAGAAAAAGGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGCAAATGTGTTACCATACAGAGAACATTGGATGGAAGGCTTCAGGTTGCCGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGGTGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGACAGTGTCTGTGTGAATCCATATCACTATGAACGAGTTGTATCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCACCAAGTATGTTGGTGAAGGATGAATATGTTCATGACTTCGAGGGACAGCCATCGTTATCCACCGAAGGGCATTCAATTCAAACCATCCAACATCCACCAAGTAATCGTGCATCAACAGAGACATACAGCACCCCAGCTCTCTTAGCTCCATCTGAGTCTAATGCTACCAGCACCACCAACTTTCCCAACATTCCTGTGGCTTCCACAAGTCAGCCTGCCAGTATACTGGCAGGCAGCCATAGTGAAGGATTGTTGCAGATAGCTTCAGGGCCTCAGCCAGGACAGCAGCAGAATGGATTTACTGGTCAGCCAGCTACTTATCATCATAACAGCACTACCACCTGGACTGGAAGTAGGACTGCACCATACACACCTAATTTGCCTCACCACCAAAACGGCCATCTTCAGCACCACCCGCCTATGCCGCCCCATCCCGGACATTACTGGCCAGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCTAATCATCCTGCTCCTGAGTATTGGTGTTCCATCGCTTACTTTGAAATGGATGTTCAAGTAGGAGAGACATTTAAGGTTCCTTCAAGCTGCCCTATTGTTACTGTTGATGGATACGTGGACCCTTCTGGAGGAGATCGCTTTTGCTTGGGTCAACTCTCCAATGTCCACAGGACAGAAGCCATTGAGAGAGCAAGGTTGCACATAGGCAAAGGTGTGCAGTTGGAATGTAAAGGGGAAGGTGATGTTTGGGTTAGGTGCCTTAGCGACCATGCAGTCTTTGTACAGAGTTACTACTTAGACAGAGAAGCTGGGCGTGCACCTGGAGATGCTGTTCATAAGATCTACCCAAGTGCATATATAAAGGTCTTTGATTTGCGACAGTGTCATCGGCAGATGCAGCAGCAGGCGGCCACTGCACAAGCTGCAGCAGCTGCCCAGGCAGCAGCCGTGGCTGGAAACATCCCTGGCCCAGGATCAGTAGGTGGAATAGCTCCAGCTATCAGTTTGTCAGCTGCTGCTGGAATCGGTGTTGATGACCTTCGTCGCTTATGCATACTCAGGATGAGTTTTGTGAAGGGCTGGGGACCGGATTACCCAAGACAGAGCATCAAAGAAACGCCTTGCTGGATTGAGATTCACTTACACCGGGCTCTCCAGCTCCTAGATGAAGTTCTTCACACCATGCCTATTGCGGACCCACAACCTTTAGACTGAGGTCTTTTACTGTTGGGGCCCATAACATTCTTTGTCAGGATGGTGGACTATAAAATACAATCCTGTTTATAATCTGAAGATATATTTCACTTTCGTTCTGCTTTATCTTTTCATAAAGGGTTGAAAAATATGTTTGCTGCCTTGCTCCTAGCAGACAGAAACTGGATTGAATCAATTTTTTTTCCTATTTAGAACTTTTCAGGCATGGCTCAGAGCTTGAAGATCAGGAAAAACACATTCTTATTAAATCTTCACCAGTTATATATGAAGGAATCATTCCAATGCTGGAAAATTTAGCCCTTTAAACTGTCTTAGACCCTTTTATATGCAGAACATCGATATGTGTGTTATTCTACAGAATAAATTCAATATTGCTGATTTTAAAGGCAGAGAAGCTCTCTAAGTTAATTCACCTATGTTATTTTGTGTGCGAGTTGTTATTGTTGAACATACTTTACTCCCAGGTATTGTGCCATGTGGGTGAGTTAATTTTACCAAGAGCAACTTTACTCTGTGTTTAAAAAATAAGATAGTAATGTATTATAACCTTTTATCCAAAATATTTTTTGCAAGTTAAACTAGTGAAGATGATTTCAATTCAGATTGTCTTACGATTTCAATTTTATTTTCGCCAAGGCAAAACACTAATCTCTGTGTATACTGAGAATTCTTTAAAATTATCAAAGTAATATCATTTAAAATTACACTCGTTATCCCTGTTGGATAACTATTTATCAAGTAGTGTACTTTTGCCCTGTTAAACAGTAGACGTAGTATATATTTCTAGGCACAAGGTTGGTTACTAAGCAGCCTAGAAGAAGAATTTCTTTTTCTTCATTAATTCATAGGGAAAGGTTTTGTATTTTTAAAAACACTAAAAGCAGTGTCACTCCACCTGATAACTTACCATTCTGCAAAGGTGGCAATGCTTAAACTAAATGATGAGTATTTTGGAAACTGCTAAATTCTGTGTTAAATACTGTGCAGAATAATGGAAACATTATAGTTCATAATAGGTAGTTTGGATATTTTTGTACTTAATTTGATGTGTGACTTTTTTTTCATATACTGTTTAAATCATGTATGTTATGACATTGTTTAAAATTCAGTTTTTGTATCTCGGGGCAAGACTGCAAACTTTTTATACCTTTTGGTTATTCTAAGCCCTTTGCCATCAATGATCATATCAATTGGCAGTGACTTTGTATAGAGAATTTAAGTAGAAAAGTTGCAAATGTATTGACTGTACCACAGACACAATATGTATGCTTTTTACTTAGCTAGTAGCATAAATAAAACCAAATCTCAACATAAAAAGTTGAATTCTAGGTTTGATTTTTAAGTTTTTTTTCTTTTGCACTTTTGAGTCCAATCTCAGTGGCAGGACACCTTCTACTAAATGACAGGCAACAGCCAGTACTGCAGCTTTGGTTTTTCCCTTACACTCTACTGGGACTTCCCCATGGACATTATATATCAAGTAAAGAATTGGTTATTTTTTGAACTTTTATTTTACTGTAGCAAAAATAGTCCTGATTGTCTACAAGATAAATAAGTTGTCTACAAGATAAGTAGTTTGAAATAAGATCAAGGATTATCTTTCAGATGCTTTTACTGTTTGTTTGGAAGGCCTTTCTAAGTGTAGTAAGATTCTAAGGTGTGTTACAAGTTTGAGATAATGAGAAGCACTTATGCATGATAGTCATCCTTATATCGACTTAGGTGAACAAGTCTTCAACTTCCTTGCTCTGAAAGTCTTAAGACCACCTAGTAACCACTGAGTTTGCTTATTGCTGTGATTTAAACATAGTTGTTGATTCAAGCTACATGTTTTTTGTTTTTAAAATAACTTCTTTACCAACTCATTTGTACTCTTGAGTACTTACAGATACCTTTGTTAAAAACCTCATTTTAATCTGTAAAAGTATGGTGATTTAAGTTTAATTGGCAGATTTTTTAAAAAGATATTTTTATTCTTTAGAGATTATTGACTTTAGGTCTATTTTACTGTGAATGAAAAGTAGGAGTGAGAGTAGAGTGTTTTAGAATGACAGATTTTTAAAATCCAGTTTATTTGATTAGAACCATAAGCATGTTATGATGTAATCTATTGCCTCCTTTTCTACTTTAAGGAAAGTTTTCATGTCTGGGGAAAGTACATGGAAAATATTTGCTAAGAAGTCTGTCTTTGAGGCCAAGCCACCTTTCTTGGTTTCTTTCTGCTAAGAGCCATAAAAGTACTAAAAGTACATAGAAGTACTTCTAGTTATTAGTTGCTACATACTTATACCTAGATGCAGTCACATGCTTTTGAGAAAACATCTAGTATGTTATGATCAGTTATTCCTGAGAGCTCAGTTGTTAAATGGTATTTCCATTTCTTAAAGGTAGTCATCTTTGATGAGTAAGACTAAATCACTAGGTTTAAAATTTGGGGCTGCTTTAAGGATAGAATAGTTTCTACAGTTCTCGGAATCTGATTATTATGAGGATACGACTCTGGGTGGG