Transcript asmbl_59358

Sequence
Transcript Sequence for observation asmbl_59358 of TGE0006294:
GTCTACGGCCGCATGCCGCTACGGAGCAGCCAGGCTAAGGAAACTAACTAAAACCACGGCGTATTCGTCGGCCCCAGCCTGGCTCCCGGAAGCACACGGCGGGCTTTGCTCTAGCCTCAGCGAGAACGCCGGCCGCATCCCCCTGTCCGGAGTTGGATCCCGCCGCGCTTCCGGTGTGTTTTCCGGTCCGCCTCCCCAGGCAGGAAGTGCCGGGCGCGGCCTCTGTCGCGCCTCAGTCCATCGCTCATCGCAGTCGCTCGTCGTCTCGTGCAGGGCACCGCGGGTTCTGGTGTTGGCGACGAATTAAACAGCCACCATGTCAAGCAAAAAGGCAAAGACCAAGACCACCAAGAAGCGCCCCCAGCGTGCAACATCCAATGTGTTCGCCATGTTTGACCAGTCACAAATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAATAGAGATGGCTTCATTGACAAGGAGGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCAACGGACGCATACCTCGACGCCATGATGAATGAGGCTCCAGGGCCTATAAATTTCACCATGTTCCTCACGATGTTTGGTGAAAAGTTAAATGGCACAGATCCAGAAGATGTCATCAGAAATGCTTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATTCAGGAAGATTACCTGAGAGAGCTGCTGACGACAATGGGAGATCGGTTTACGGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGAAATTTCAATTACATTGAGTTCACGCGCATCCTTAAACATGGAGCAAAAGATAAAGATGATTGAAAGAACTTTAGCTAAAACCTTTCGATTTCTTTGTCTTACTCTGTTTTATTTCCCCAGCACTTTCCCCAACATTTATCGACCTGTTGCATGCAACTTAGTTTCACAGCTTTGCCTCTTTTTTTTGATGTATTTATTCTAGACCTTTCTGCCAATTAGCACTTGTATAATCAGACTACAGATGGGGATGAGGTTGTAAATTGAAAAAGATTGCGAATAAAAATCAACAAATGTGAAAGCCCAGGAAAATATATTTGGTATTTCTGGTTTTGCTGGATTTTTACATTTTTATATAATAAAAATGCTATTTTGAAATCAAAA