Transcript asmbl_58999

Sequence
Transcript Sequence for observation asmbl_58999 of TGE0006272:
CGGGAAGCGAAGACGCAAGCAGCTAGACCGTGGGGAACCGAGGTAGGAGTTAACTGTTGTAGCGGCGGAGGAAGTCGGGAGGACGCCGACGGCCTTGCGGGCCAGTGTTTGGTCCCTTTAACCTGTGAAGATGGTGTTGCTCACGATGATCGCCCGAGTGGCGGACGGGCTCCCGCTGGCCGCCTCGATGCAGGAGGACGAACAGTCTGGCCGGGACCTCCAACAGTACCAGAGTCAGGCTAAGCAGCTCTTCCGGAAGTTGAATGAACAGTCCCCTACCAGGTGTACCCTGGAAGCTGGCCCCATGGCTTTTCACTACATTATTGAACAAGGGGTGTGTTACTTGGTTTTGTGTGAAGCCGCCTTCCCTAAGAAGTTGGCTTTCGCCTACCTAGAAGATTTACACTCAGAGTTTGATGAACAGCATGGGAAGAAGGTGCCCACTGTGTCTAGACCCTATTCCTTTATTGAGTTTGATACCTACATTCAGAAAACCAAGAAGCTCTACATTGACAGTCGTGCCCGGAGGAACCTAGGCTCCATCAACACTGAGCTGCAGGACGTGCAGAGGATCATGGTGGCCAACATCGAAGAAGTGCTCCAGCGAGGGGAAGCGCTCTCAGCATTGGATTCAAAGGCTAACAATTTGTCCAGTCTGTCCAAGAAATACCGCCAGGATGCGAAGTACTTGAACATGCGTTCCACTTACGCCAAACTCGCAGCCGTGGCCGTGTTTTTCATCATGTTGATAGTGTATGTGCGATTCTGGTGGCTGTGAAGTCGCGAATCCAGTCACTGGCAAGGGAGAACGTAGAACCTGACAGGTGTATGTTTTCGGGAAACCGAGCTCACAGAGATATGTATTAGAATCCAACTGGAACTTCCGCCTCTAAAGACCTTGCGAGAAAAGACACATCCTGAAAATGAAAGGTCACACCTCCTTTCATGCAGCTTAACCCCATGTAGAAAGTCTCTTTTGGGGGCAGACGCTTTCTCTGGGTGCTAAGCCGTATGTACGTTAGGGAACAGTAGGTCGTTGCATTTTGTTTTTTCCTCTCCTAGTGTTTTACATTTTTTTAAAGCTGCACTTACTGGGGCATCTTCATCCTCTAACAGAGCCATCAGTGAGATTGGGGTTAACCAACCTGTGCTAGCAGCAGTCTGAAATTCCTTCAGAGAAGGAAGCCCTTTGGGAAGTTTTTGACGATCTAATCAACATTCCTTTTGTCAGCGACATTTGTGATTTTCCGTAATCTGAGTTTTCGATGGCCTTTTCAACAAGACTCCAGCATGTGAAGGTTCATTGCTGTGTGTGCTGCAAAGATCTTGTCTCTTGGCCCCGATAGGAAGTTAACCTTTGTTCCCCTTTTGTATTTTGCTTATTGCACAATTGCTTTAGGGTTAAATTAATTATATTAAGATGCCTTGAAATTATATTATAGCACTCCTTGATTAAGAAGCTAAAATGTTTTCTGTCATTTATTCCTTAAAAGACTTAAGTTAGTTTGGGACAGTCTTTATTTTCAGCATCTGATGTGTGTTAATTAAAGAGGGAGGATAGTACACAGATAGCCAGAGGCCCCTGACTCAATGAGAACAGACCGTGACTGCGGCTTTGTCCCTCCCCTTCCTCACTGTCCCCGCTCGTTTCCCCCACTCTCTTTCCTCCTGCCTCAATTTGCTAACAATTTAAAAACTCTTGTGCCCAATAGTTTCATGTCCCTTAAGTGTCCTCTCAGGACAGTCTCAGATTTCAAAATGGAGAACGTTCAGCTGTGTAGTTCATTACATTTAAGTTTTTGCAGAGTGACAAAAACTACTAAATACGTTTACCCGGAACGTCTCTCAGAGCACCCCACACCTGCTTCAGTTTGTAGAAGTTCTCTGAGAATGTTCTAGACATAGAGAACTCATTTACAGTGGCTTCTGTTCACAAATAAAAGGACCTGCGATTGTCCCCTTTTTGCTCAGGGATAATGGGGATTTCCTTGTACCTTCTGAGACAGAATTTTTAAAATGCGAGGATAGGCCTTTTAGATATGTCACAAGGGTCTGCGCTATGACCTATAACTCCTACATATACTGAAAATATTTCTTTAAATTGTACAGGAAAATGAGCCAACTTCTTACTTCTTAACATCCTGAAAAAACTCCAACCAGTGAGCAATTTTATAATGCTGTGGGGTCATCAAATCTACTGTCCTGATTCCTGATAGAGGAAAAAAAAAATTCTATTTCCTTCTAACAAGGCAAGGAGAAACACTTTTATTCCTGATAATTTACAGAACTAGAATAAAATTTTTGTCTTTCCATTTTGGACCTAAATGTGCCAGTTGGCATTTTGTGCATGGAATATGAAATTACTTTTTATAGAGAATAAGTGCTTTTCGGTCCCAAAGGCTTGTCCCTGAGTAATGATGGTGGTAACGCGAGCCTTCGAAAGGGGGAAAACCTGAGCAGTGGCGCCCTAGCGTCCGGTGCTCCTGGCACAGGGAGCGTGGCAGCTCGTTGTCGAGAGTTGCATGCTGTAACCAAGTGGCCAGCAATGAAATAAATACTTCTAGAATGTTTCCTTCAGTGTGAAGTTTTGTTACCTAGTTTATTTATGCA