Transcript asmbl_58973

Sequence
Transcript Sequence for observation asmbl_58973 of TGE0006270:
GGAGCCTGCAACTCTCGCGAGAGAAGCGAGATTTATTCCTACGTACCGGGCCGTGCTGCTTATGGCGGCGCTGGAAAGGGGGCGCTGAGCTGTTGGGTATGAAGTGTAACAGAACAGACTTTACCACCTGAAACTGCTGCTTCAAGTTCAGATCAGGCAAGGAACAAACCTCGAAACAACCAACAAGACCAAAGAAGAGTACACTTTAAATTGAAGACACAACACTTGATCTGAAACAAGAAGTTTGTGCCTACTCAACAGCTTTGAAAGAGCACTTCCCAACGCTGCTAGTAGTCTTTGTTTTCTTCAGTGCTGTACTGTGAGATTGCCCGGTGCAGCAGCAGTTGTATTCTTTATTAGCCTGATAGATCATTTTCTCTCGCTCTTTTTTTTAATACTAGCAACTTTCATCCTTTGAAACGTGTGCTGAAAAAGAAGAATCAGCAAATACTACTGAAAGTGCAATATTTGATTATCACTGCGAGATGAGCTTTGATCCAAACCTTCTCCACAACAATGGACACAACGGGTACCCTAATGGTACTTCAGCAGCACTGCGTGAAACTGGGGTTATTGAAAAACTGCTAACCTCTTACGGATTTATTCAGTGTTCAGAACGTCAAGCTAGACTTTTCTTCCACTGTTCACAGTATAATGGCAACCTGCAGGACTTAAAAGTAGGAGATGATGTTGAATTTGAAGTATCATCTGACCGGCGGACTGGGAAACCCATTGCTATTAAACTGGTGAAGATAAAACCAGAAATCCTCCCTGAAGAACGAATGAATGGACAAGTTGTGTGCGCTGTTCCTCACAACTTAGAGAGTAAATCTCCAGCTGCCCCGGGTCAGAGTCCAACAGGGAGTGTATGCTACGAACGTAATGGGGAAGTGTTTTATCTGACTTACACCCCTGAAGATGTGGAAGGGAATGTTCAGCTGGAAACCGGAGATAAAATTAACTTTGTAATTGATAACAATAAACATACTGGTGCTGTGAGTGCTCGAAACATTATGCTGTTGAAAAAGAAACAAGCCCGCTGTCAGGGAGTAGTTTGTGCCATGAAGGAGGCGTTTGGCTTTATTGAAAGAGGTGATATTGTAAAAGAGATATTCTTTCACTATAGTGAATTTAAGGATGACTTAGAAACCTTACAGCCTGGAGATGACGTGGAATTCACAATCAAGGACAGAAATGGTAAAGAAGTTGCAACAGATGTCAGACTATTGCCTCAAGGAACAGTCATCTTTGAAGATATCAGCATTGAACATTTCGAAGGAACTGTAACCAAAGTTATCCCAAAAGTACCCAGTAAAAACCAGAGTGACCCATTGCCAGGACGCATCAAAGTTGACTTTGTGATTCCTAAAGAACTTCCCTTTGGAGACAAAGATACAAAATCCAAGGTGACCCTTTTGGAAGGTGACCATGTTAGGTTTAATATTTCAACAGACCGACGCGACAAATTAGAACGAGCAACCAACATAGAAGTTCTATCAAACACGTTTCAGTTCACTAATGAAGCCAGAGAAATGGGTGTAATTGCTGCCATGAGAGATGGTTTTGGTTTCATCAAGTGTGTGGATCGTGATGCTCGTATGTTCTTCCACTATAGTGAAGTTCTGGATGGGAACCAGCTCCATATTGCAGATGAAGTAGAGTTCACTGTGGTTCCTGATATGCTCTCTGCCCAAAGAAATCATGCTATTAGGATTAAAAAGCTTCCCAAGGGCACGGTTTCATTCCATTCTCATTCAGATCATCGTTTTCTGGGCACTGTAGAAAAAGAAGCCACTTTTTCCAATCCTAAAACCACTAGCCCAAATAAAGGCAAAGAAAAGGAGGCTGAGGATGGTATTATTGTTTATGATGATTGTGGAGTGAAATTGACTATTGCTTTTCAAGCCAAGGATGTGGAAGGATCTACTTCTCCTCAAATAGGAGATAAGGTTGAATTCAGTATTAGTGACAAACAGAGGCCTGGACAGCAGATTGCAACTTGTGTGCGACTTTTAGGTCGTAATTCTAACTCCAAGAGGCTCTTGGGTTATGTGGCGACTCTGAAGGATAATTTTGGATTTATTGAAACAGCTAATCATGATAAGGAAATCTTTTTCCATTACAGTGAGTTCTCTGGTGATGTCGATAGTCTGGAACTGGGGGACATGGTCGAGTACAGCTTGTCCAAAGGCAAAGGCAACAAAGTCAGTGCAGAAAAAGTCAACAAAACGCACTCGGTGAATGGCATTACTGAAGAAGCTGATCCTACCATCTACTCTGGTAAAGTCATTCGCCCCTTGAGGAGTGTTGATCCGACACAGACTGAGTACCAAGGAATGATTGAGATCGTGGAGGAAGGGGATATGAAAGGTGAGGTCTATCCATTTGGCATAGTTGGAATGGCCAACAAAGGGGATTGCCTACAGAAAGGGGAGAGTGTCAAGTTCCAATTGTGTGTCCTGGGCCAGAATGCACAGACTATGGCCTACAATATCACACCCCTACGTAGGGCCACAGTGGAATGTGTGAAAGATCAGTTTGGCTTCATTAACTATGAAGTAGGAGATAGCAAGAAGCTCTTTTTCCATGTGAAAGAAGTTCAGGATGGCATTGAGCTACAGGCCGGAGATGAGGTGGAATTCTCAGTGATTCTTAATCAGCGCACTGGCAAGTGCAGTGCTTGTAATGTTTGGCGAGTCTGCGAAGGCCCCAAGGCTGTTGCAGCTCCACGACCTGATAGGTTGGTCAATCGCTTGAAGAACATAACCCTGGATGATGCCAGTGCTCCTCGCCTAATGGTTCTTCGTCAGCCAAGGGGACCAGATAACTCAATGGGATTTGGTGCAGAAAGAAAGATCCGTCAGGCTGGTGTCATTGACTAACCACATCCACAAAGCACATCATTAATCCATTATGATCAAGTTGGGGGGATTCTGGTGAAGGGTTCTGAATATCTCCCTCTTCATCCCTCCCAAAATCTGGAATACTTATTCTATTGAGCTATTACACCAGTTTTAACACCTTCCTCGTGTTATGTTTAAAAAAAATAAATAAATTTAAGAAAACCATTTTAAAATTATGCACAGTTGCAGCCTGGAAAACTTAAGGTGGCGCCTTATAGTATCAATTTTAGAAGCTTTATTTGGTGCATTTAACGCAACTGGTAATTGCAAAATCCACTTCCCCTGTGTAAGTGAAAAGTATAGACTGTTATCTTGTTGGCCCTATGAAATTCTGCACTTGATATTCAGTATATACTCTACCTTCATTACTTCTGGCAAGGTGTTCGGCCTTAGCACTCAGTTGCATTCTTTCCTGTTCATTATGCTTTAATTCTGAGGACCATATGAGGGTAGAATATATTAAAAATTACAAAAATTTGTATAGGCGAACCATTTCCTTAAGTTGGTGGCCAAATGTTAAAATGTTATTTTTCATATCATTTATAATCTTGTCACAGTCCACTTAACAAAGTTTGGTTAGATTTCAATGAAAATTATCTTCCAGAGTAGTTTTTTTTTCCTGGGATGGGAGGGGGGTAAACTTTACTACAAATAGTATGTATGGTGCAGAATTTCATGCAAATGAGATGTGCCAGCAGTGTGATAATTTAAACGTATTTAAACAGAAACAACAAAAAAGGACAAATGCACAAACTCGCTGCTGCTTAGATCACTGCAGCTTCTAGGACCCAGTTTCTTTTACTGATTTCAAAACAAAACAAAAAAATAAAAAAGTTGTGCCTGAAATGAATCTTGTTTTTTTTATAAGTAGCCGCCTGGTTCCTGTGTCCTGTAAAATACAGGCACTTGACCCTTGGTGTAGCTTCTGTTCGACTTTATATCACGGGATTGGATTGGTCTGATTTCTTGGCCCTCATCTTGAATTGGCCACATACAGGACAGGGTCCCTGGCCAGTGGACTGAAGGTTTTGTCCACAAGATGACAAAAGGTCAGCTCAGGGGATGTGTGGGAGGGCACTTTTATCTTCCCCATTGTCATTTGAGTTTTTGATCTCTGGGTAAAGAGGCCGTTTATCTTTGTAAACACAAAACATTTTTGCTTTCTCCGGTTTTCTGTTAATGGCGAAAGAATGGAAGCGAATAAAGTTTTACTGATTTTTGAGACACTA