Transcript asmbl_58930

Sequence
Transcript Sequence for observation asmbl_58930 of TGE0001954:
CTCAGTTCTGCGGCAGTGTGAGTGGATAGAGTGGCGGTGCACTCGTGTTGGCTCTCAAAATCCCCGCGTAGCCACTGTCGCCTTTTCCAGCCCTCGCCATGTTCCTCACCCGGTCTGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATCGAGGCTATCAAGCTTGGTTCTACAGCTATTGGAATCCAGACATCAGAGGGTGTGTGCCTAGCTGTGGAGAAGAGAATTACCTCCCCACTCATGGAGCCAAGCAGCATTGAGAAAATTGTAGAGATTGATGCTCACATAGGTTGTGCCATGAGTGGGCTAATTGCTGACGCTAAGACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACATACAATGAGACAATGACAGTGGAGAGTGTGACCCAGGCTGTGTCCAATCTCGCTCTGCAGTTTGGAGAAGAAGATGCAGACCCGGGTGCCATGTCTCGTCCGTTTGGAGTAGCACTGTTATTTGGAGGAGTTGATGAGAAAGGACCCCAGCTGTTTCATATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCAGAGGGTGCCCAGAGCTCTTTGCAAGAAGTTTACCACAAGTCTATGACACTGAAAGAAGCCATCAAATCTTCACTCATCATCCTCAAACAAGTAATGGAGGAGAAGCTGAATGCAACTAACATAGAGCTAGCCACTGTGCAGCCCGGCCAGAATTTCCACATGTTCACAAAGGAGGAGCTCGAAGAGGTTATCAAGGACATTTAAGGAAGCGTGATCCTCAGAGCTTCTCTGGGACAGTTTCAGTTCTCCTAATTGCCCTTAACTTTTATTTCCAGCTCATATTCCTTGGAAAATCTCCAGTATATGTGCATTTTTTTATGATGTCTGTACATAAAGGCAGTTCTGAAATAAAGAAAAATTTAAAGTATTTGTTAATAGACTATTCTAATGCAGTCTTTTATTCAAACTGCTTATGTTAGGGAGCAAGAAAGATAGTGGTATTCATATCCCTGCCCTCTCAGAGTATCTATTCTGAAATAATTTTAGTGGCTTGCTGCAACAGAATCAACTATATCATGAGTTCCTGAGTGTTGGCAATGAACTCAAACTAATCCAGCTCCTCCCAGTGGTTTAAGATGTTAATACCATTGTAAAGCCACTTCAATCCTATAGTTAATCTTGAGTAAACAGGTATTTTTGCTGCTTTTCTTATATGAAGGAGATGCTACTAATTGACCATCAAAAGAACATGTTTTGAGGTCCTCCCCAAACCCTGATGAACAGTTAGAATACACCAGCTATGATGTTGTACCAGTTCTAGTGTCTTAACAGACAATTTGAAAAGAGATTTAAAAAAAAAATTTAGGTAAGGACAATAAAAATGGAATTCAATTACAAAACGAGTATGAGAGAATGGTATAATTCTTCAGTAGTTTATATTAAACACTTTGGAATGTACTATGAACTTCCTCCATTAGAGCTGCCATCATATAACTGGTTGAGATTAAAGAATCAGTCTATTCGAGCCTCAAAAATGGCCATATAAAGTAGATCTCATTATTGTATTTAACATGAAGAATCTAAGGCTGTGTGACTGGACAGAAAATTGAGTTGTTAGGAACCAAACTCAGATTTTCTGGTTTCAAATCATCAACTCTTTGTTTTACGACGCCAGGTCCTTTGAAGCCTAGACACCTACTGAGTAATGGGGAAATCTCATCGAGATTTGAAATGTATTTGCAACATCCACAATGTGGCTAATCAACATGTGGATAATGCAGAATTGATTGTGTATTGTCTTCATTAACATTTGTAGGAAGTTGTACTCTGTGATGTCAAAATAAATGCAGATGATTTAAGTAGGCTGAATTTATATTAAACTCACCATATTTCCAGCATAAAACAGCTTGTGCTTATTATATACATTTGGAAACTCCTATGATGGGAAATATTTAGAAGAATTTTGCCCTAGACATACACATAAGGAAAGTATGAGAACTTTATTGTCACTTATGTTCTGGAGACTGACTTCTACT