Transcript asmbl_10826

Sequence
Transcript Sequence for observation asmbl_10826 of TGE0003561:
GCCGCTGTTTCGTAGCCGGGGCTGCGGCCGCAAGAAGAAGGATCTCCCTCTCGCTCCCCGCCGGCGCCTGGCCCGCCCGCTACGCCCCGACGCGTCTCCCATGCCTGCCCCCGGCCCGGCTGCCGACGGACGTCGCGTCAGCGCCCGGATTTAACACGGAAGCCCGGGTCGGGGGCCGCGGGGGGAGGACGAGGGAGACCCGGTAGGTCCCGCGCCCTTCTCGGCCCGGCGCGGCGCCTCGGCGGGAGCCATGACCTCGCTGACCCAGCGCAGCTCGGGCCTGGTGCAGCGGCGCACCGAGGCCTCCCGCAACGCCGCCGACAAGGAGCGGGCGGCGGGCGGCGGCGGCGGAGGCAGCGGCGAGGACGACGCGCAGAGCCGCCGCGATGAACAGGACGACGACGACAAGGGCGACTCCAAGGAAACGCGGCTGACCCTGATGGAGGAGGTGCTCCTGCTGGGCCTCAAGGACCGAGAGGGTTACACATCTTTTTGGAATGATTGTATATCATCTGGATTACGTGGCTGTATGTTAATTGAATTAGCATTACGAGGAAGATTACAACTAGAGGCTTGTGGAATGAGACGTAAAAGTTTGTTAACAAGAAAGGTGATCTGTAAGTCTGATGCCCCAACAGGGGACGTTCTTCTTGATGAAGCTCTGAAGCATGTTAAGGAGACTCAGCCTCCAGAAACAGTCCAGAACTGGATAGAGTTACTTAGTGGTGAGACGTGGAATCCATTAAAACTGCATTATCAGTTAAGAAATGTGCGGGAACGATTAGCTAAAAACCTGGTAGAAAAGGGTGTACTAACAACAGAGAAACAGAACTTTCTACTTTTTGACATGACGACACATCCCCTCACCAACAACAACATTAAGCAGCGCCTCATCAAGAAGGTTCAGGAAGCTGTTCTTGACAAATGGGTGAATGACCCTCACCGCATGGACAAGCGCTTGCTGGCCCTCATTTACCTAGCCCATGCCTCCGATGTTCTGGAGAATGCTTTTGCTCCGCTTCTGGATGAGCAGTATGATTTAGCTACGAAGAGAGTGCGGCAGCTCCTTGACTTAGATCCTGAAGTGGAATGTCTGAAGGCCAACACCAACGAGGTTCTGTGGGCGGTGGTGGCAGCATTCACCAAGTAACTCTGCTCAGAATGAAGTATTCTCCTTCCTCTCATGTAAACCAGTAGTTTTTCTTCTATTGACTTCTGGTTTTCTGCAGTTTGTATTTTCCCACACTATAATTGGCTTTTATTTTATGAAATAGTAAGTGGCTTTTTAAAAATATATATATATGTATGCAGGATTCTGCTGGTACGAGAGGCCTTCCTCTTTCTGTTTTAAAAAAAGTTTTACTGCCATATTGGCATTCCATTCCTTGTTGCCATTCTCACCATTACCTGTTTGGGGTTTCTGGTATGCTTTGACTTTCAAAGTACCTCCAGTCTCCTTACATGCACATCTTTTGGATTACCTCAGGTTGAGTTGTTCCCACATGTGCATGCACATCTCATATTCTGCCTACAGTTCAGACGGAAGTCACAAAAAGGCCTTTAACTCACCAAAGGTAAATATCTTTATCTATTAGGACATTTTATACATAGACCTCAGTTGAGATGTATACTTAGCAAAATTATTTTTAAATTGAAACAACACAGTAAATAATATAAAATGCCCCTTGGATTTTGCTTCCCATACGAATCTATTATAAGACTTGTTATAATTTTAACTATTAAATCACAAAGGTCCAGTCGTTTCACAAAGCCAGTTTGGGATAGGCTGCATTCCAGTTATGCTGTATATAGTTTGAATTATATATAAATTGCCCCTTCTGGCCACCCCACCTCCATCTTAGTATTTTGCAAGATTTAATTAGTTGCACACCTGGTGCCCCTCACTTGCTTTAGTCATTATTTGATGGCAAAATAGACCCCTCATCATTGAAGGAGAGAGAGGTGTGTCTGGTCCTGATATTTTTTTAGCTGTGCCATTCATGGCACTCTTTGCCTATGCATCTCCTTTTTGGAATGATTTTTGAGTCTTACTGTTTTTATCATTTCTGTAGGGAAGAGGCTTGTGACCAGTACTAATCTTGAGTACAGTTTTTTCTTTTTTTGACCATAAGTAAATTAATGTCTGCTCTTAAATGTCATTTATCGACTCACACTTTCTTGGGGAAAAAAATTAAATGTCAGTCCTAGCAGATTTTGCATGTAAATTGTTAGCAAGTGATGACTACAATTCAGATGATTAAGAATTTTGTAACAGAAGCTCTGCTATGTTTTAATTTTTATATACAATTATGATAATTAGCACATTGTAAGAATATAAACCTTTGCTTTTTAAAGTTTATTTTTACTATTTCTTTATCACTGTTTATCATATCACCATTGGTTTCATAATGTAAATACTATATATTGAAAAAACGTCAAATTTTGTATTACTGTAGTTCATGTTAATAGTGGGGCTTTCAGGTGTTTAGAGATTTTTTTGGTTAACAGTCAATGCAAAAGTACTAGATGGTGTATAACTCTAGAGTTGAATTTTAAGGGATTCTCTAATCTGTATACTACCTTTTTAACTGAAGTAATAAAATAAACTATGATCT