Transcript asmbl_58028

Sequence
Transcript Sequence for observation asmbl_58028 of TGE0006234:
GGTGCGGTATTGAATCCTGTTTGAGCTGTCCTCCTTTTCCTGCAGAATGGCACTGTCTAAGAGGGAGCTGGATGAGCTGAAACCATGGATCGAGAAGACAGTGAAGAGGGTGCTGGGTTTCTCAGAGCCCACGGTGGTCACAGCAGCACTGAACTGTGTGGGGAAGGGCATGGACAAGAAGAAGGCAGCTGACCATCTGAAACCTTTTCTTGATGATTCTACTCTCCGATTTGTGGACAAACTGTTTGAGGCTGTGGAGGAAGGCCGAAGCTCTAGGCATTCCAAGTCTAGCAGCGACAGGAGCAGAAAACGAGAGCTAAAGGAAGTGTTTGGTGATGACTCTGAGATCTCGAAGGAATCATCAGGAGTAAAGAAGCGACGGATACCCCGTTTTGAGGAGGTGGAAGAGGAGCCAGAAGTGATCCCAGGGCCTCCCTCAGAGAGCCCTGGCATGCTCACTAAACTCCAGATCAAACAGATGATGGAGGCAGCAACACGACAAATAGAGGAGAGAAAAAAACAACTGAGCTTCATTAGCCCCCCTACACCTCAGCCAAAGACTACTTCTTCCTCCCAACCAGAGCGACTTCCAATTGGCAACACTATTCAGCCTTCCCAGGCAGCCACTTTCATGAATGATGCCATTGAGAAGGCAAGGAAAGCAGCTGAACTACAAGCCCGCATCCAGGCCCAGCTGGCACTGAAGCCAGGGCTCATAGGCAATGCCAACATGGTGGGCCTGGCCAATCTTCATGCCATGGGCATTGCTCCCCCAAAGGTGGAGTTAAAAGATCAAACTAAACCTACACCACTGATTCTCGACGAGCAAGGTCGCACTGTAGATGCAACAGGCAAAGAGATTGAGCTGACACACCGCATGCCCACTCTGAAGGCCAATATTCGTGCTGTGAAGCGGGAACAATTCAAGCAACAGCTGAAAGAAAAGCCATCAGAAGACATGGAGTCCAATACCTTTTTTGACCCCCGAGTCTCAATTGCCCCTTCCCAGCGCCAGAGACGCACTTTTAAATTCCATGACAAGGGCAAATTTGAGAAGATTGCCCAACGATTACGGACAAAGGCTCAACTGGAAAAGCTGCAGGCAGAGATCTCACAGGCAGCTCGAAAAACAGGCATCCATACTTCAACTAGGCTAGCCCTCATTGCTCCTAAGAAGGAATTAAAGGAAGGAGATATCCCTGAAATTGAGTGGTGGGACTCTTATATCATCCCCAATGGCTTTGACCTTACAGAGCAAAATCCCAAGAGAGAAGATTACTTTGGAATCACAAATCTTGTTGAACATCCGGCCCAGCTCAACCCTCCAGTTGACAATGACACACCAGTTACCCTGGGAGTATATCTTACCAAGAAGGAACAGAAGAAGCTTCGAAGGCAGACAAGGAGAGAAGCACAGAAGGAACTCCAAGAGAAAGTCAGGCTGGGCCTGATGCCTCCTCCAGAACCCAAAGTGAGAATTTCTAATTTGATGCGAGTGTTAGGAACAGAAGCTGTTCAAGACCCCACGAAGGTAGAAGCCCATGTCAGAGCTCAGATGGCAAAAAGACAGAAAGCGCATGAAGAGGCCAACGCTGCCCGAAAACTTACAGCAGAACAGAGAAAGGTCAAGAAAATTAAAAAGCTTAAAGAAGACATTTCACAGGGGGTACACATATCTGTATATAGAGTTCGAAATTTGAGCAACCCAGCCAAGAAGTTCAAGATTGAGGCCAATGCTGGGCAGCTGTACCTGACAGGGGTGGTGGTACTGCACAAGGATGTCAACGTGGTAGTAGTGGAAGGGGGCCCCAAGTCCCAGAAGAAATTTAAGCGTCTTATGCTGCATCGGATAAAGTGGGATGAACAGACATCTAACACAAAGGGAGATGATGATGAGGAATCCGATGAGGAAGCTGTGAAGAAAACCAACAAATGTGTACTAGTCTGGGAGGGTACAGCCAAAGACCGGAGCTTTGGGGATATGAAGTTCAAACAGTGCCCTACGGAGAACATGGCTCGGGAGCATTTCAAAAAGCACGGGGCCGAACACTACTGGGACCTTGCGCTGAGCGAATCCGTGTTGGAGTCCACCGACTGAGGCCGCCGCGGGCCCTGGCCTCTGCCCGCTGGCCTGCGTCTCTTCAGTCCTCCCCCTCGTTCTCCTTCCCAGCCCAGCCCCCCGTGTGTGTGATCTGAGAACTGTGCCACGCCGACATCGGGACAGAAGGAGAGCACTGGCTCCCCTCCCGTCAGCCTGGTGCTGCCCTTTCCTCTATGTGCATACGATTAAAGAGTTATTTTTAAAGGTGGTATGATATTTTTCACACACTCATAGGATTGGAGTTTGGGTCTTCAGGTGATCCTTTCTCCAGACTTGTAGCAATTGCTGTGGGAAAAAAAATTTGTCATTGGTATTTATGTATATATGAGTGGGTGGAAGGAAGGATGGATTTGT