Transcript asmbl_57942

Sequence
Transcript Sequence for observation asmbl_57942 of TGE0025301:
CCGCTGCCGCCGCCGCCGCCGCCGCGATGCCCCGTAAGTTCAGCTGCCGGCAGCTCCGGGAGACAGGCCAGCGCTTCGAGAATTTCCTGGTGGAGAAGGGACTGGACACGGAAACAGACCGCGAGAAGCTGCGAACCCTTTATAACCAAGACTTCAAGATCAGCTCTGGGACCCCCAACCCTGGCTTCTCCTCCATGCTGTACGGGATGAAGATTGCAAATCTGGCCTTCGTCACCAAGACTCAGGTCAGGTTCTTCAAACTCGACTGCTGGGCCGACGTGTCATTGCCAGAGAAGAGGAAAATGAGGCTGGGGTCCGATATCAGCACACACCACAAGTCACTGCTAGCCAAGATCTATCACGACAGGGCTGAGTATCTTCACGGAAAACATGGTGTGGACGTGGAAGTCCAGGGGCCCCATGAAGCCCGGGATGGGCAGCTCCTTATTCGCCTGGATTTGAACCGCAAGGAGGTGCTGACCCTGAGGCTTCGCAATGGAGGAACGGAGACTGTCACCCTCACCCATCTCTTCCCACTCTGCCGGACCCCCCAGTTTGCCTTCTACGATGAAAAACAGGAGCTGCCCTGTCCACTGGGCCCTGGTGAGAGCTACGACCTCCACGTCCACTGTCGGACCACTTTTGTGGGCTACTTCCCAGCCACGGTGCTCTGGGAGCTGCTGGGACCTGGGGAGCCCAGTTCCGAAGAAACTGGCACTTTCTACATTACCCGCTTCTTGGCGGCCGTCGCCCACAGTCCTCTGGCAGCACAGCTGAAGCCCACGAAGCCATACAAGCGGATCCCGATCACTGGAAAGCCTGTAGTGACCACCCGGATAGAGGAAGGAGAGAGACCTGACTGTACGAAGGGCTATGACCTGGAGCTAAGTATGAAGTTGGAGATGTATAACCCACCCCCCAGCCTCCGGCAGCTGCTCCCCAAACTTCAGGGAACAAGCGTCTTCACTGCCCCAAAGGACATTGCTAAAATCAAGGCCCAGCTGGAGACAGCCCTAAAGTCGAGGAACTACGAGGTGAAGTTCCGGCTGCTGCTGCATCTGGAAGAGCTGCAGATGGAGCATGACATCCGGCACTATGACCTGGAGTCGGTGCCCATGACCTGGGACCCCAAAGACCAGAACCCCAGGCTGCTCACGCTGGAGGTTCCCGGGGTGGCAGAGAGCCGCCCCTCAGTGCTCCGGGGAGACCACCTGTTTGCCTTGTTGTCCTCTGAGACACACCAGAATGACGCTGTCACCTACAAGGGCTTTGTGCACAGGGTGGAATTGGACCGTGTCAAGCTGAGCTTTTCCCCAAGGTGGGTGTTGGGGAAACCCTGAGCTGCTTGAAGGGTCTACAGACATCTCTGTGAGGCTAGGGGAGGAGGGGTGCTTCTCCCCGAGATGAGCTGGGACCACAGGGCCAGGGCAGGAGGCTCTTCTTCAGGGGGACTCTGACATACTTCGGCAGCTTCTTTTCTTGGAGGGATTGCATGGAGCTCTTGAAGGCGGGAGTGGAGCTAGGGCGGTGGAGAG