Transcript asmbl_10809

Sequence
Transcript Sequence for observation asmbl_10809 of TGE0003559:
GGTGCCGGGACGCCCCATGAGTCGGGGGACCATGCCCCAGCCTGGAGCGTGGCCGGGCGTGAGCTGTGCGGAGAAGCCGGCGCCGGAGGCGGGGGCCGCGTCTCCGGGCCCGGCCAGAGCCGCGGCGCGGGATGGAGGGAAGGCGTCGGCCAGTGGGCAGCCGCTGGCTGCGGTGCGGTGTCCGGCCGAGCAAGAGGAAGACATATATCGTGCCGCGGATGAAATAGAAAAGGAGAAAGAATTACTTATACATGGATCATCAGAACCCAGATTAAGTGTAGCTCCTGAAATGGATATCATGGACTACTGCAAAAAAGAATGGAGGGGAAATACGCAAAAAGCAATATGTATGAAAAAGGGCTATGAAGAAGTATCTCAGAAATTCACCTCCATCAGGCGAGTCCGCGGAGATAATTACTGTGCGCTGAGGGCCACGCTGTTCCAGGCCATGAGCCAGCCGGCGGCTCTGCCCCGCTGGCTGCAGGACCCGGAGCTCACGCTGTTACCGGAAAAACTCATAAGCAAATACAACTGGATCAAGCAGTGGAAACTTGGATTGAAATTTGAGGGGAAGAGCGAGGACCTGGTTGATAAAATCAAGGAGTCCCTCACTCTGCTCAGGAAGAAGTGGGCAGGCTTGGCTGAACTGAGAACTGCCGAAGCAAGGCAGGTAGCTTGCGATAAACTGTTCACCAATGAGGAGGAGGAGTATAGCCTGTATGAAGCTGTAAAATTTTTAATGCTAAACAGAGCCATTGAACTATACGATGATAAAGAGAAGGGAAAGGAAGTGCCATTTTTCTCTGTGCTTCTGTTTGCTCGGGACACGTCGAGTGACCCTAGACAGCTGCTGAGGAACCATCTAAACCAGGTGGGACACACTGGTGGCCTCGAACAGGTTGAAATGTTCCTCCTGGCCTACGCTGTGCGCCACACCATCCAGGTGTACCGGCTCTCCAAGTACAGCACTGAAGAGTTCATCACCGTCTACCCCACAGACCCGCCCAGGGACTGGCCGATGGTGACCCTGATCGCCGAGGATGATCGGCACTACAACGTCCCCGTCAGGGTGTGTGAGGAGACGAGTCTGTGAGAGACGCTCGCCCGGCCAGCCTGGCGGCACGGCCAAGGTGCGCAGGCAGCTCCTGGGCTTGCCCGGCCTGCCGGTCCGGAGGGACTTCTGGGGACTCTGGGGTCCTGGGAGCCAGGGAGGCCCACAGCCCTCTGAAGACTGGCTTTCAATAATAAGAGTTAGCCAAGCTTTTCCTCGTCTGTGATGCGGTATGTTTCGGTGGGGACCTTCAGCGCACACCTGTTGGAAGGTACAAACGCCATCTTTTCCATAAAAAAAACACTTTTGTGTCAGGAGACTCATTTTGGAGAGAAATATGTTTTTTATATCTCAAAACAAACTTTCTCTAATAGTAAACTGGTTTGCATTTTTTTTTAAGATAGTAATTGTTTTTGTTTTGGTGGTAATGGGTCACTGTCGTGCCTTCTGTGCAGTCCGCTTAGGTATAATGCTGGGTGCAGTTCGTTAATGGCGCAGTCGTAACATCCTGTGTTGGTCTAGTCAAACAAAGGTTTGGATTTACATGTTCATTAAAGCCATTCTAAACAGATTTTCTAATAGAAGATTAAGAATTGGGGCCAAAAGTGAGTTATTTAAAGACTGGAGAAGGAGCTGCAGGATGGAGGTGATGGCACCTGGAAGTCCTTGCTCTTCGAGAACATGACAGGTGCCCACGGTCACGGGCACACCAGGTCTGGCGCTTGGTGCAGGTGCTGCTCTGTCAGCGGGCTGAGCGCACCTCGTAGTCAAGTTCTAGGGCCTGTTCATCATTCCCCACTTTTGCAGACTGACACTATATGGTCAGAATCAGAGCTCAGGTCCGCCTGCTTTTTTAGAGTTGGGAGCCAAGACGAAACGAATTATGGCTCTCATGTGATTCAGAGCTGGGATGAGTCGGACCCAGGTCTTCCTGTGCCCTTCTCACACTATTTTTTGAGGGTCTTTCCATTGCCAGAGTCCTGCACTCATCTGCTGGCAGGGGATGAGTGACAGCAGAGTGTGTCCTAGGGTTTGTCACGAGTAAGTTTAAGCAGAAGCGTGTACTAAAACTGCGTGCTGAAGTAGGGCTGAGCCGGATCTGCTCTCACTTTGGGTTGGGAGCCTGAGAGAAGCATCGTTCCTGGCCGTGAGCAATCGCCTCCACGGTCTGCGTCGGGGCCTGATTCGCCCCGTGGGGCATGGACTGTGGACATCCTTCATCGCTCTTTAGGACTGTGTCAGCAGCACCCGAATTGGCTCAGCATTTGTGGAGGTGATGTTACCCTGAAGTTCCGAGCTTTATTTCAGAATAAAACTCTTTATTTGGTTCAATTTAATAAAATTTATAAGCTATCTAATCTGTTTTTTTTCAGTTTGAAAATGTAAGTTTTGCTTTCACTTAAAAATTAAAATTCTTAGTTGAGAAAACTAAGAGCACACACAAAACTATGCAGAATGTTACATTAGTATTTTCTTCATTACCTCATCAGTAATGTTGGCCACATTTTGGTAGCTGCTGATTCATTGAATCAAATTTAATGTTACATGTGTGTGAATGCATCCAAGAGGCTTGTGTTTTCCACTGTGAAATGTGATGGTATCTGGAATAGGAGGTACC