Transcript asmbl_57554

Sequence
Transcript Sequence for observation asmbl_57554 of TGE0006181:
GGCCCGTGTTTTTTAATAATATCCAACTCAGTGCATGCCAAGGACTGATGATAGGTCCTTGAAATGCTGTGAAGTACACCTTTGGATATGTGAGGTTGCAGGAACATAAATATTTTAACACCGGTTCTTCCCAGTACTCTTTTAGAGGTCTTGGCAGACAGATTCCTTTCTTGTCTAGATTTGTAAGAGGTTTAAGGTGCAGAATAAGTTTCTCCTTTTGGAGTTGAGGTAAACTTTCAAGGTCAATGATGTGTTGGCATGTATTACCTGAATTTATGGCTGATGTGTAATAACACGAGCTCTAGAATTACGCTGAGACCTTGAAAAACTTACTTGGTTTCCTTTCTGGGACAATCTTAGAAAATTAGTGAATGAGTCAACTGAAAAGTATTTTTCCCTGGAGTATCCAAACAACTGGATTATATATACCATCTTGGAAAACATCGTTGATAAGTTCTTAAGTGTTTGGTTCCCATAACTTTGTAGTTACGGAGTTGTTAGGGCAATGTTTATTTTTTATCTACTGCTCACTTGATTTCTTTAAAACTGAGTTTTGGGTTCACAGCAAACCACTAAGACCACTCACTGATTCAAAACCTTAAAATATAAAGCATTGGTGACCATAGCAAAAATTTGTTTCTGGAATCTTCGTGCCAGTTTTTTTTTGATTTGTTTTAATGGCTCCATTATTAGCCACTCTTACCCATTTTATCTTTTGTATGTATTGGCCATTTTGGTTTGCAAGTAGTTAAATCATTTACTGATAAAAAGGTTTCATAAAGAGTATATGTTAAAAGAATGTCTAATAAGTACATTTCTTAAATGTTTTCCTCGAACTTGTGAAAGGTCTTTTTCTGACTTACGTTTGGCTTTTGGAAGAGATTAAAGCTGTATTTGTATTGTCAGTAAATTGAGTTTATCATGCTTTTCAAGATAGTAGTCCCCTCATGCCCCAAATTTGAAAGCCACAAGTTTAAACTTATTGATGATGGATTAAGTGAAGTAAAAAGTAACTGGCTAGCTTTCTGTGTTCAATCTCTACCCCCGCATCAATTCAAACGGCACATTAATTGTGTATTTTAGGAATACTGTATGTCTGAGTATTTGAGAATGAGTGGCATCTATTGGGGTCTGACTGTAATGGATCTTATGGGACAACTGCATCGCATGAATAGAGAAGAAATTCTCACATTTATTAAGTCATGTCAACATGAGTGTGGTGGAATAAGTGCTAGTATTGGACATGATCCTCATCTTCTGTACACTCTGAGTGCTGTCCAGATTCTTACTCTGTATGATAGTATTAATGTTATCGACGTAAATAAAGTTGTAGAATATGTTCAGAGTCTACAGAAAGAAGATGGTTCTTTTGCTGGAGATATTTGGGGAGAAATTGATACAAGATTCTCTTTTTGTGCGGTGGCAACTTTGGCTCTATTGGGAAAGCTGGATGCTATTAATGTGGAAAAGGCAATTGAATTTGTTTTATCATGTATGAACTTTGATGGTGGATTTGGTTGTAGGCCAGGTTCTGAATCTCATGCTGGGCAGATCTATTGTTGCACAGGATTCCTGGCTATTACTAATCAGTTGCATCAAGTAAATTCTGATCTACTTGGTTGGTGGCTTTGTGAACGACAGTTACCTTCAGGTGGACTCAATGGAAGGCCAGAGAAGTTACCAGATGTCTGCTATTCATGGTGGGTGTTGGCTTCCCTAAAGATAATTGGAAGGCTTCATTGGATTGATAGAGAGAAACTACGTAATTTCATCTTAGCGTGTCAAGATGAAGAAACAGGAGGATTTGCAGACAGGCCAGGAGATATGGTTGATCCTTTTCATACTTTATTTGGAATTGCTGGATTGTCACTTTTGGGAGAAGAACAGATTAAACCCGTTAGTCCTGTTTTTTGCATGCCTGAGGAAGTACTTCGGAGAGTGAATGTTCAGCCTGAACTAGTGAGCTAGGTTCACTGATGCATAAGTTGCTCAATATAGTTTTGCCATCTTAACATTTCTGTATTTGAAGTGCTTACCAAACAATATGTTAATATTTTGTATATGTATTGATTTTTAATAAATTGTATAATTATACATATTGTAAAATAAAGGCCTAGTGTGTCTTCAGCTTTTCTGAGTACAATATTTGGTTTATACTTTAATGTATTTATATTCTTTGTAGCAGTAATCTTTAAGAACTATTTAGTTGAAGTCAAGTGTTATACTTGATTTTATCCTGTGCTTCCTTCATATTTTTATGTATGATAGTTCATGTAAATTGGTCTGTGTCAGTGATAATGTTAACTGATAAAAAAAATTGATAAGCCTCATTCTAAATATGAATTAAAAGATTTACAAAAACAAATGGCTGTTGAAATTTGGGAGTATTTCATAGGTTTATGGTTAACTCTGAGTTGGTCACAGTGATTTAGGTAAATGACAGTTCGTCTTAGAATATGATTACAATCGGGACTACACTTTATTCTCATTTTTAACATGTCAAAATGCCAGCTTCTTAAGCGATGGTTGGTCTTTTCCCCTTAATAAGGAGACAAGTAATAGTTGCCACAATATTTTGTGTACCCGTGTTTTCAGAAAGACTAAAATGAGCACAACTATTCTCTAAAAGTTTTTACATTCTTGGTGAAATAAAGTATTTTAATGAACATTTTTTGCGAGGTGAAAGTTGAAATTTTTCTCAAGTGTGTTTGCAATAAC