Transcript asmbl_57454

Sequence
Transcript Sequence for observation asmbl_57454 of TGE0006178:
GGAAGATGGCGGCGTCCAGGTGGCGGTCTTGAGGAGACCGAACCGGTATGGCTTTGGCGTCGGGCCCCGCAAGGCGGGCGCTTCGTCTACCTGGAAGGCTCGGCTTTGGGGGCGACGGGACCCCGAGACGCGGGGCGTACGAGTGGGGCGTTCGCTCCACGCGGAAGCCCGAGCCTCCTCCCCTGGACAGGGTGTATGAAATCCCTGGACTGGAGCCCATCACCTACGCGGGGAAGATGCACTTCGTGCCCGGTCTGGCGCGGCCGGTCTTTCCGCCGTGGGATCCTGGCTGGACGCACCCAAAGTTCCGCCGCGCGCCCCCGATCCAAGAGCATCCGCTGTACAAGGACCAGGCCTGCTACACCTTCCACCAGCGTTGCCGCCTCCTCGAGGGTGTAAAGCAGGCTCTCTGGCTTACCAAGGCCAAGTTAATAGAAGGCCTTCCTGAGAAAGTGCTTAGCCTTATTGAGGATCCAAGGAACCACATAGAGAACCAAGATGAACGCGTTCTGAATGTGATCTATCACGCCCGTCTCTGGCACTCCACTGAAAACATCCCCAAGAGAACGACCTACTGCCCAATCATTGTGGACAGTCTGTTACAGCTGTGTAAATCCCAGACTTTCAAGCATCCTTCACTAGCCAGGCGGATCTGTGCCAAAAACTACACGTTATCCACCACTTGGAATCGAGAGTCTCTTCTCCTTCAGGTCCGTGGTTCTAGTGGAGCCCGACTGAATGCCAAGGACCTTCTGCCCCCCATTGCCTCCAGAGAGGAGGTAGAAGCTACTAAGAATCATGTTCTTGAAACCTTCTATCCCATATCTCCCACTGTCGATCTTCAGGAATGCAATGTTTATGATGTGAAAGACGACACAGGATACCGGGAGGGTTATCCTTATCCCTATCCCCACACCCTGTATTTTCTGGAGACAGCCAATTCACGACCATACCGCTTTCAACCAGATCAGCTGCGGGCCAAGATGATCCTGTTTGCCTTTGGCAATGCCTTGGCTCAGGCCCGGCTCCTCTATGGGAATGACACTAAGGTTTTGGAGCAGCCAGTAGTTGTGCAGAGTGTGGGCACCGATGGACGTGTCTTCCAGTTCTTGGTGTTACAACTGAACACCACAGATCTGGCCTCTAATGAGGGCATCAAGAATCTGGTGTGGGTGGACTCAGACCAGCTCCTCTATCAGCATTTTTGGTGTCTCCCAGTGATCAAAAAGAAGGTGGTTGTGGAACCTGTTGGGCCGACTGGTTTTCAGCCAGAGACGTTCAAGAAGTTTTTAGCTTTGTATTTGCACGGTGCTGTATGAGCCAAGGACTGTTCTGCAGCCTCACGTACCCCCTCGCTTCAACCCACCGAAGACCCTGCAGCCTGGGCAGGGCCTGGGGTCTGCCCGGAGCCTCAGTGCTCTTTTGGCCTGGTGGGCTCGCTGACAATAACGAGTGCTTCCAGTGCACTGGAGTCTGTGCTTGGTGTGAGGGTGCTGTTGGGAGGGACATCCAGTTTCATGTGGGCCCACACCTTGAGCCTGCCGCCATATAAATGCAGGCCCTGGAGTCTGACCTGCCGCATCTCTGCCCACCACCCATTTTGTGACTTTAGATAAAAGTCTTCATCTAAGTTTCAATTTCTTCATCTGAAACTTGGGCCTAACATAACCTACCTTATTTTGAAGACTATAGCTTATGTATGTGTATTGTCTGTCACATAGTAGGTGCTCTGTGATGGTTGCTCAGTTCTTTTGGGGTTATTTAAATTGTGGACACATTCACAATGACTGCAGAAATTCTGAATAGAATATTCATTGTAGATTTCTCAGCTAGTGTCCTGGTTACTGGACCAGTACACCCCTGGTTCAGCTGGCCTCCTATTTGTTCT