Transcript asmbl_15084

Sequence
Transcript Sequence for observation asmbl_15084 of TGE0000357:
TCCGTTAAAATGGCGCCCTGGTGGCCGGCGGCGCCCGCGCCTTAGCCTGTCAGGAGCAGGGAGCTTGCGGGGCGCAGGAAGGGCGCGGGCCGCGGTCCCTGCGCGTGCGGCGGCAGTGGCGGCTCTGCCCGGACCACCGTGCACGGCTCCGGGCGAGGATGGCGACCCCGGACCAGAAGTCGCCGAACGTTCTGCTGCAGAACCTGTGCTGCAGGATCCTGGGCAGGAGCGAAGCTGATGTAGCCCAGCAGTTCCAGTATGCTGTGCGGGTGATTGGCAGCAACTTCGCCCCAACTGTTGAAAGAGATGAATTTTTAGTAGCTGAAAAAATCAAGAAAGAGCTTATTCGACAACGAAGAGAAGCAGATGCTGCATTATTTTCAGAACTCCACAGAAAACTTCATTCACAGGGAGTTTTGAAAAATAAATGGTCAATACTCTACCTCTTGCTGAGCCTCAGTGAGGACCCACGCAGGCAGCCAAGCAAGGTTTCTAGCTATGCTACGTTATTTGCTCAGGCCTTACCAAGAGATGCCCACTCAACCCCTTACTACTATGCCAGGCCTCAGACCCTTCCCCTGAGCTACCAAGATCGGAGTGCCCAGTCAGCCCAGAGCTCCGGCAGCGTGGGCAGCAGTGGCATCAGCAGCATTGGCCTGTGTGCCCTCAGTGGCCCCGCGCCTGCGCCACAATCTCTCCTCCCAGGACAGTCTAATCAAGCTCCAGGAGTAGGAGATTGCCTTCGACAGCAGTTGGGGTCACGACTCGCATGGACTTTAACTGCAAATCAGCCTTCTTCACAAGCCACTACCTCAAAAGGTGTCCCCAGTGCTGTGTCTCGCAACATGACAAGGTCCAGGAGAGAAGGGGATACGGGTGGTACTATGGAAATTACAGAAGCAGCTCTGGTAAGGGACATTTTGTACGTCTTTCAGGGCATAGATGGCAAAAACATCAAAATGAACAACACTGAAAATTGTTACAAAGTAGAAGGAAAGGCAAATCTAAGTAGGTCTTTGAGAGACACAGCAGTCAGGCTTTCTGAGTTGGGATGGTTGCATAATAAAATCAGAAGATACACGGACCAGAGGAGCCTGGACCGCTCATTCGGACTCGTCGGGCAGAGCTTTTGTGCTGCCTTGCACCAGGAACTCAGAGAATACTATCGATTGCTCTCTGTTTTACATTCTCAGCTACAACTAGAGGATGACCAGGGTGTGAATTTGGGACTTGAGAGTAGTTTAACACTTCGGCGCCTCCTGGTTTGGACCTATGATCCCAAAATACGACTGAAGACCCTTGCGGCCCTAGTGGACCACTGCCAAGGAAGGAAAGGAGGTGAGCTGGCCTCAGCTGTCCACGCCTACACAAAAACAGGAGACCCGTACATGCGGTCTCTGGTGCAGCACATCCTCAGCCTCGTGTCTCATCCTGTTTTGAGCTTCCTGTACCGCTGGATATATGATGGGGAGCTTGAGGACACTTACCACGAATTTTTTGTAGCATCAGATCCAACAGTTAAAACAGATCGACTGTGGCACGACAAGTATACTTTGAGGAAATCGATGATTCCTTCGTTTATGACGATGGATCAGTCTAGGAAGGTCCTTTTGATAGGAAAATCAATAAATTTCTTGCACCAAGTTTGTCATGATCAGACTCCCACTACAAAGATGATAGCTGTGACCAAGTCTGCAGAGTCACCCCAGGACGCTGCAGACCTATTCACAGACTTGGAAAATGCATTTCAGGGGAAGATTGATGCTGCTTATTTTGAGACCACCTGACCAACATGGTGAAACCCTGTCTCTACTA