Transcript asmbl_56353

Sequence
Transcript Sequence for observation asmbl_56353 of TGE0006121:
ATACTAAAGTGTGTTCGCTTGACGGCGAGCAGAGCCCAGCATCCGCGAGGGGCCGACGGCCAGGCTCGTCTCTCTCACGTAACTCACTCTCCTTCCACGCCGTGAGCCTAGAAAGATTGTGCGATGAATGGTGATACTCGAGCCGTCGTGGTGACCTCACCACCCCCGACCACAGCCCCTCACAAGGAGAGGTACTTCGACAGAGTGGATGAGAACAATCCAGAATACCTGCGAGAGAGGAACATGGCCCCAGACCTTCGCCAGGACTTCAACATGATGGAACAGAAAAAGAGGGTGTCCATGATTCTGCAGAGCCCCGCCTTCTGTGAAGAATTGGAATCAATGATACAGGAACAATTTAAGAAGGGGAAGAATCCCACAGGCCTGTTGGCATTACAGCAGATTGCAGATTTCATGACCGCCAATGTACCCAGCGTCTACCCGGCAGCCCCACAGGGAGGGATGGCAGCCTTGAACATGAGTCTTGGTATGGTAACTCCTGTGAATGACCTTAGAGGATCTGATTCGATTGCCTATGACAAAGGGGAGAAATTACTGAGGTGTAAATTGGCAGCGTTTTACAGACTAGCAGATCTCTTTGGATGGTCTCAGCTTATCTACAATCATATCACAACCAGAGTGAGCTCCGAGCAAGAACACTTCCTCGTTGTACCTTTTGGACTTCTCTACAGTGAAGTGACTGCATCCAGTTTGGTGAAAGTCAGTCTGCAAGGAGATATCATAGACCGTGGAAGCACTAACCTGGGAATAAATCAGGCCGGCTTCATGTTACATTCTGCCATTTATGCTGCACGACCCGACGTGAAGTGCCTTGTGCACATTCACACAGCAGCGGGGGCTGCGGTCTCGGCGATGAAATGCGGCCTCTTGCCCATCTCTCCGGAGGCGCTTTCCCTTGGAGAAGTGGCTTACCATGATTATCATGGCATTCTGATTGACGAGAAGGAAAAAGTTTTAATTCAGAAAAATTTGGGGCCTAAAAGCAAGGTCCTTATTCTCCGGAACCATGGGCTCGTGTCTGTCGGAGAGAGCGTCGAGGAGGCCTTCTACTACATCCATAACCTCGTGGTTGCATGTGAGATCCAGGTTCGAACTCTGGCCAGCACAGGAGGGCCAGACAACTTAGTCCTCCTGGATCCTGGGAAGTACAAAGCCAAGTCCCGTTCCCCGGAGTCCCCGGCAGGGGAGGGCACCGGATCACCTCCCAAGTGGCTGATTGGTGAGCAGGAGTTTGAAGCCCTCATGCGGATGCTTGATAATCTGGGTTACAGGACTGGCTACCCTTACCGATACCCGGCTCTGAGAGAGAAGTCTAAAAAATGCAGCGACGCCGAGGTCCCTGCTGGTGTCGCAGGTCACTCCTTTGCTAGTGACGGCGATTCAGGCACTTGCTCCCCTCTCAGACACAGTTTTCAGAAGCAGCAACGCGAGAAGACAAGATGGCTGAACTCTGGCCGGGGCGACGATGCCTCTGAGGAAGGGCAGAATGGAAGCAGCCCCAAGTCGAAGACTAAGTGGACTAAAGAGGATGGACATAGAGCTTCCACCTCTGCTGTCCCTAACCTGTTTGTCCCATTGAACACGAACCCGAGAGAGGTCCAGGAGATGAGGAACAAGATCCGAGAGCAGAACTTGCAGGACATTAAGACGGCCGGGCCCCAGTCCCAGGTTTTGTGTGGTGTAGTGATGGACAGGAGCCTCGTCCAGGGGGAGCTGGTGACAGCCTCCAAGGCCATTATCGAGAAGGAGTACCAGCCCCACGTCATCGTGAGTACCGCAGGCCCCAACCCCTTCACCGCGCTGACGGACCGGGAGCTGGAGGAATACCGCAGGGAGGTGGAGCAGAAGCAGAGGGGCCCCGGAGAGAGTCTGGACGAGACGACGGAGCAGAGAGACGGCAGTCCGCCGGAGCCCCCTGCCGCTCCGCACACTCCCCCCAGCACCCCTGTTAAGCTGGAGGAAGACCTGCCGCAGGAGCCCGCTTCCGGAGACGACAGTGATGCCGCCACTTTCAAGCCAACTCTCCCCGACCTGTCCCCTGATGAGCCTTCAGAAGCGCTTGGCTTCCCAGCCCTGGAGAAGGAGGAGGAAGAGGGGCTTTGTGAAGCCCGTGGCCCTCCCGGCCCCACCAGGCCCCCCGCGGCGGCTAGCCCCGAGCCGGTCGCAGCCCAGGCGGCTGAAGAGGCTGCCTCCCCAGCGGCCGAGGACGGGGCTGCCGTGGATCCTGGCAGCGATGGGTCTCCAGGCAAGTCCCCGTCCAAGAAGAAGAAGAAGTTCCGCACCCCCTCCTTCCTGAAGAAGAGCAAGAAGAGGGGCGACTCCTGAAGGCCCGTCCCGCGCAGACCCATGCCACCGGACCGTCCCCGCCTGTGCCCCCCGCTGTCTTCTCGTGTAATGGAATGCAAAAAGCCCACCCCTCCGCATAGCTAGAGCCCCTTCCCGCCATGGCCAACGCCCACGCAGATGGGTGCTGACCTGCCCCCGGCCCTCAGCCTCAGGTCCCAGGGAGACCCAGCCCACGTCCACCTCCGTACTGTCTCACTGTTCCTCGGTGACGTGCTCTTGAGAGGCGTTCAGCCACGGTTCTGGCCAGACTGTCAGAGGCTCTGTGGTCTGGCCTTGACCCCTCTTGCTCTCCTGTCGTGCAGTGACCCATGCTGTCTGCTAGGCTCCCCTTCACCCCAAGGTCTCAGGTGACTGCTGAATCAGATGTGTAGCTTCCTGCCGGCGCTGTCTGCCCAGTGATCTCTCTTGGTTCACACACACAAGGCCTCAGTCCTGTGAAAACACCGTGTGCCTGCCAGCGGCCCAGGGCACCGTGGCGGCCTTTGGGAGGCGGGTCTGGGCCGAGCTGGAAACCCCAGCAGCGGACGGGCCTGTGTGCAGCCAATGCCACCTATGCATGGTCTAACCGGTTACCCCGCAGCCAGGAACGATTCAGGGCTCACAGCTCCTCACTCACTGGGGTCCTCAGGAAGGGAAGAGTCTTTTCTAGAATTTTCTTTCAGCACATGTGCGGTTCACCCCACACTTCTGTGAATACGAATGGCCACTTTTTGCTTTCGTTCTCTCTGGGGCCTGCTGCAGAGCAGCGGTCACCTGTTGTGGGGGAGGTTTCAGAACTGAGAGGGCTCTACTCCTACTGTAACTCAGCCCGAGCGACACCGTGGCTGCGGTCCAGGGCGGCTCAAGGCAGAAGTCGGCCCTAGGGGTCCCCACCTGACCCCGTGCCCCACGCCTGCCCTCCCTGCTCACACCAGTGTTCGCACTTAACTCAGATCCCCGGAAGGAGCGTCAGGCTGCTCAGTGGGAACTAGCGGGTGGCCACGGGGACTCCTCGAGGGTGACCCGTTGCAGGAGCTGCCCCGTGCCGACCTGACTAGGTGTGGGCAAGCCTGCCTGCTCCCCAGGCAGGCCCCCTGGGGACAGGCGGGGTCCTCGGTAGAGCTGGCACCTGACGGGGCTCGCGTCCCGCAGTCCGCACACCCGTGCGGGCCTCGAGGCTGGCCGCCGCTTCGAGCTCACGGCGAGCAAGCTGCTTTTCTCGTGTCGTTTTGTTGCCGAGGTGTGCTAAAGGCCCCATCGCGCCGTCCCTCAGTTAAGCACGGACTCTTCCGCTGTCACTTTCTTTGTCCCTCACACGCAGTGACTTTAATTTCACTTTTGTAGCGTAACCTCGTCACCACGTGCAGTGCAGTTGCGCGCGCAGACACGGGCCGGGAGGGCGAGCCCTGCGTCCTTCCTCCAGTGAACCGCGTTTTACTCACAAATAAAATTCTTTCAGCAGCTCCCTCGTCCG