Transcript asmbl_10463

Sequence
Transcript Sequence for observation asmbl_10463 of TGE0003542:
AGTCCCAGGCGCGTTCCCCCACCACTGTGCGACCCCGCCTTTTTCAACACCCTGGGGTGAGCCGAGCTTGGGCCAATATCAGGAAAGCCCCTGAAAGTCCCAGCCCAGCCAAGAAGTAACAGGACCCTGCCCAGTCCCGGGAGCAGAGCGGCCAGGAGGAGGAAGGCTCCAAGGCGCCCCCGCCCTCGGGTCCGCTACTTGCCGGGTCCCTATTGGCTGGCGCGCTCGGCGACTGAAACAGCCGTGGGAGGGGAATTCTCGTTTATAAAAACTGCGCCCTTGGCAGGGTCCCGTCCTCTGCAACTCTTGCTCCGGGGTCCCCGCGCCAGAGACGCAGCAGCGCTCCCACCGCCCACACCCACCGCGCCCTCGCTCGCCTCTCCGCCGAAAGCCAGTCCGCGCCGCCGCAGCTGCCCAGCCCGCCACCACCCTCCGCAGTCATGTCCACCAGGTCCGTATCCTCGTCCTCCTACCGTAGGATGTTCGGCGGCCCAGGCACCGCCAGCCGGCCGAGCTCCAGCCGGAGCTATGTGACCTCGTCCACCCGCACTTACAGCCTGGACGGCGCGCTGCGCCCCAGCACGGGCCGCAGCTTGTACGCCTCGTCGCCCGGCGGCGTGTATGCCAAGCGCTCCTCGGCTGTGCGCCTGTGGAGCGGTGCCCCCCGCGTGCGGACGCTGCAGGACTCGGTAGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGTACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAACAAGATCCTGCTGGCCGAGCTCGAGCAACTCAAGGGCCAGGGCAAGTCGCGCCTGGGGGACCTTTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTCACCAACGACAAGGCCCGCGTGGAGGTGGAGCGCGACAATCTGGCCGAGGACATCATGAGGCTCCGGGAGAAGTTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAGAGCACCCTGCAGTCCTTCAGACAGGATGTTGATGGTGCTTCTTTGGCACGTCTTAACCTTGAGCGTAAAGTGGAATCCTTGCAGGAAGAGATTGCCTTTTTGAAGAAACTCCATGACGAGGAAATCCAGGAGCTGCAGGCCCAGATTCAGGAACAGCATGTCCAGATCGATGTGGATGTTTCTAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAGTATGAAAATGTGGCTGCCAAGAACCTTCAGGAGGCTGAGGAATGGTACAAGTCCAAGGTATGAACCAAGCCAGTGTGGCTGGAACAACAGGAAAGCATTTTGTTCTACAAATGCTGTACCCGTCTCTGATTCTTAAATACCCTTTAAATCCAGTGAGAAAGGTGGCTTTAAGTTCAAGTTTTGTTTGTTGTTACAGCCTCCCCACTACTCACATTCCCTAACCTCCCCCCAGAAGCAGACCCCCTTCCCATTACCCTATTTTGATTCTACTTCAGAGTAAACCCCAACACCATGACCTTGACCTCCGCCCTTTTTAAATGGGAGTAACAAAGTGAGTTTCTACTTGAAAATATCAGCGTCAGTATTCCACTGCTCTTTCTCCGGTTTTCAAAACAGAAATTCAGACACGTTTTGGCAGACATTGAGCTTTGAACTTAAAATATAAAATCTGGTTTGTATCGTGATTTGTTTGTTTGCAATTTTTAAGCTTTCTCATTTGTCCAGGTAAGGTAGCATCTTAGAATTGAGTCACTTAGATGGTCTACATTTCTGATTTCTTCCGACAGTTTGCTGACCTCTCCGAGGCTGCTAACCGGAATAATGATGCCCTGCGCCAGGCGAAACAGGAGTCAAATGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGACGCGCTGAAAGGATCTAATGAGTCTCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCTATGGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAACATGAAGGAAGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTGAATGTTAAGATGGCTCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTGCTCTGCCTCTTCCAACCTTTTCTTCCCTGAACCTGAGGGAAACCAATCTGGATTCGCTCCCTCTGGTTGACACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAATGAAACTTCTCAGCATCACGATGACCTGGAGTGAAAATTGCACAGAGTTGGTGCAGCAATATTATTACCAGCAACAATAAAAAAGAAATTCATTTCTTAAAGAAACAGCTTTTAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGAAATAGAAATAAGCTCTAGTTCTTAAGAACCAACACTCCTAAAAGATTTAGAAAAAAGTTTACAACGTAATCTAGTTTATGAAGAAGTCTTGTGCTAGAATACTTTTTAAAAAGTATTTTTGAATACCATTCAAACTGCTTTTTTCCAACAAGTATCTGACCAATGTGTCTCTGCTTCAATAAATCTTTGAAATCTGTTTCGGTGTCTTATTTGATAATATATGTACGATTCTCTAAATTTTATGAGGCTGTGTTTGAGTTAAAAAATTTTTTTCCTATTGGTTAGTTTGCCACAAAAATCAAGTTTAGGTCAACTTATAAATTAAACTTGTATAGTTCTTAGTTTGGTCATTTTAGATAGACTTCACTTTTTCAATTAATTTACAAATAAATGCTATAAAAATAATTTGTGCAAAAATGATAGATATTTTCATGAAATGAGTTC