Transcript asmbl_10461

Sequence
Transcript Sequence for observation asmbl_10461 of TGE0003539:
AGCGCGCAGGGAGCAGCGGGAAGGCGCTCGGGAGCCGGAGCGGGCGCGGCGGCGGTGGGCCCGAAAACACTAGAATCTTCTGGTGCCATCAGAAATGTCTCCCTTAAGTGGCAAAGTCCAGACTGTCTTGGGGCTGGTGGAGCCGAACAAACTGGGCCGCACCCTGACCCACGAACATCTGACAATGACCTTTAACTGCTCTTACCACCCACCGCCTCCATCTCATGAAGCTCTCTCTCGGGAGCCTATTATGATGAAAAATTTGTTTTGGATTCAGAAAAACCCTTACTCCCATAAAGAGAATCTTCAGCTGAATCAGGAGACGGAAGCCATCAAGGAAGAACTGTTGTATTTTAAAGCCAAAGGTGGAGGGGCCTTGGTGGAGAACACGACCACTGGGATCAGCCGCGACGTGCAGACTTTGAAGCGGCTGGCGGAAGAGACGGGCATTCACATCATATCTGGAGCTGGGTTTTACGTGGATGCAACTCACTCTTCTGAGACCAGAGCCATGTCGGTGGAGCAGCTGACTGACGTCCTCGTTAATGAAATTCTCCATGGAGCTGATGGGACCAGTATCAAGTGTGGCGTTATTGGAGAAATCGGTTGCTCCTGGCCTCTGACTGACAGTGAAAGGAAGGTTCTCCAGGCGACGGCTCATGCCCAGGCCCAGCTCGGCTGTCCTGTTATCATTCACCCTGGAAGGAATGCAGCCGCACCCGTTCAGATCATCCGAGTACTGCAAGAAGCAGGTGCAGACATCTCCAAAACAGTTATGTCGCACATCGATAGGACTATACATGATAAGAAGGAACTACTGGAGTTTGCTCAACTTGGCTGTTACTTGGAATATGATCTCTTTGGTACCGAACTCCTTCATTACCAATTCAACCCAGATATTGACATGCCTGATGATAATAAAAGAATTAGAAGGGTGCGTCTTCTGGTGGATGAGGGCTATGAAGATCGAATTCTGATGGCACACGACATACACACGAAGCACCGGCTGATGAAATACGGAGGTCACGGCTATTCTCACATACTCACCAACGTTGTCCCTAAAATGTTGCTCAGAGGTATAACTGAGAATGCGCTTGATAAGATACTGATAGAGAACCCTAAGCAATGGCTGACTTTCAAATAGGATGGTTAGGAATTCACACCTTGAGCATAAAGCTTACAGAGATCATCCGGTGGTTTCGAACCCAGTGAGTTATCAATCAGACCTACATAGGGCTAATGACAGATCATTTGCATTTTATGGGAATTAGAAGAGTTTTCCCTTCTCAGAAACTGGCTATTACATCTGAACCTGCAAGGGGCCTCACTCAGCCCACTGCCTTAACAAAATAAATACACAAAATACCTATTTCCAAACCATGATTTACAGTCTATATCCTCTTGGTAGAGTTTTGTTTTGTTTTGTTTTCTTAATCTATCAGCTGTACTACTTGTGAAAATTTAAAGTGTTTCTAGTTAAATTACCCCCTTCTGGAGCAATCTAATGTTTCTTGTAGTATTGATGATCCTACTAATTATCCTGCTGTTCTTTAATTAATGCTTAATGAATAATATGGCACTTTAAAATAAAACAGCTTCTGCAGCAAGGGAAGTTAAATTCTGAGATTTCTTTTCAACGAATACTGTTAAGACAAATACCAATTCAACAATGGTAAAACTATTGTGGAAAGATAATTATATGCTGTCCACCTGTCTGTACATAATTATAATAAATCCTCAGTGTTGCC