Transcript asmbl_55310

Sequence
Transcript Sequence for observation asmbl_55310 of TGE0025196:
CTGGAGCAAAAGGATTAAAGAATATTCAACAGAACAAACATTTTTGTTTTTTGCTAGGATAACACCTATCCTGAGATTTTGCGTTCTAATTTAGGATCAGTTGTGTTACAGTTGAAGAAACTTGGTATTGATGATTTGGTGCATTTTGATTTTATGGATCCACCAGCTCCTGAAACTCTGATGAGAGCTCTAGAACTTTTGAATTATCTGGCTGCTTTAAATGATGATGGAGATCTGACTGAATTGGGATCCATGATGGCAGAGTTTCCTCTAGATCCACAGCTCGCTAAAATGGTTATTGCAAGTTGTGACTACAACTGTTCTAATGAGGTCCTATCTATTACTGCTATGTTGTCAGTCCCACAGTGTTTTGTTCGCCCCACGGAGGCCAAGAAAGCCGCAGATGAGGCCAAGATGAGATTTGCCCACATTGATGGAGATCATCTGACACTGCTGAATGTCTACCATGCTTTTAAACAAAATCATGAATCGGTTCAGTGGTGTTATGACAACTTCATTAACTACAGGTCCCTGATGTCAGCAGACAATGTACGCCAGCAGCTATCACGAATTATGGACAGATTTAATTTGCCTCGCCGAAGTACTGACTTTACAAGCAGGGACTACTATATTAATATAAGAAAAGCTTTGGTTACTGGGTATTTTATGCAGGTGGCACATTTAGAACGGACAGGGCATTACTTAACTGTGAAAGATAACCAGGTGGTTCAGCTGCATCCCTCTACTGTTCTTGACCACAAGCCTGAATGGGTGCTTTATAATGAGTTCGTTCTTACAACAAAGAATTACATTCGGACGTGTACAGATATCAAGCCAGAATGGTTGGTGAAAATTGCCCCTCAGTACTATGACATGAGCAATTTCCCACAGTGTGAAGCTAAGAGACAGCTGGATCGCATTATTGCCAAACTTCAGTCCAAGGAATACTCACAATACTGAATCCAGTGCTCAGAACTGAAGTTATTCAGAGGACAGCTTTAAAAGATGAATGAACTCAAAAGTTCAAGTTGTGCTCTTCACGTTGGTTCAATAATGGCCTTTATTTGAAAGCTTTTTAATTTTTCTTTACAGTAAATATTCCATTCTGATTTCATAAATTAAACATTTATGCCTCCCTTTTGTGTTGACACTGTAGCTCATACTGGAAAAGTCGATCAATGTTTTGCAGTTTATTGAAAGTAGTTCTATATATAACAATGTTATAAGCATTTCTTTAGAAATGGTTGAAAATGCTTCTAAAATGTGATTATCGACCATGGTATGCATGATCGTTGTAATTGTTGACATTCCTTTTAGAAGTTGTGAAATGTTACAACTTGTGCTTATGTAGACACAATCTTCTGTCTCAGTACAGAGGCACTGACTTCAATAAAGTCTATTTATACTAATTTCGGCCAAAGCACTTTGATATCTTTGTTCTATCTTTGTAAAGTATGGCTTCTTCTCTTCCCAATGTGGGACTTTTTCCCCTATTGTAAGTATACTATGATTACGTATTTAGCATCTTCCCTCAAGG