Transcript asmbl_10456

Sequence
Transcript Sequence for observation asmbl_10456 of TGE0003538:
CCCTCATTTTTGTACTTCGAAATAAGTAAAAATTACACACATTGTAATATATTTCTCTTTTTCAGGTTGTTGGATTGGCCGCAAAGCAAAGTAGAATAAGAAATATTTCAAATACAGTAATGAAAGTAAAGCAGATCCTTGGCAGAAGCTCTGATGATCCACAGGCTCAGAAATACATCACAGAAAGTAAATGTCTAGTCACTGAAAAAAATGGGAAATTACGATATGAAATAGATACTGGAGAAGAAACAAAATTTGTTAACCCAGAAGATGTTGCCAGACTGATATTTAGTAAAATGAAAGAAACGGCACATTCTGTCTTGGGCTCAGATGCAAATGATGCAGTTATTACTGTTCCATTTGACTTTGGAGAAAAACAAAAAAATGCTCTTGGGGAAGCAGCCAGAGCTGCTGGGTTTAATGTTTTGCGATTGATTCACGAGCCATCTGCAGCTCTCCTGGCTTATGGAATTGGACAAGACTCCCCAACTGGAAAAAGCAATATTTTGGTGTTCAAACTTGGAGGAACATCCTTGTCTGTCAGTGTCATGGAAGTTAACAGTGGACTATATCGTGTTCTTTCAACAAACACTGATGATAACATCGGGGGGACACATTTCACAGAAACCTTAGCACAGTATCTAGCTTCTGAGTTTCAGAGGTCCTTCAAGCATGACGTCAGAGGAAATGCCCGAGCTATGATGAAATTGATGAACAGTGCTGACATTGCAAAACATTCTTTGTCAACTTTGGGAAGTGCCAATTGTTTCCTTGACTCATTATATGAAGGTCAAGATTTTGACTGCAATGTGTCCAGAGCAAGATTTGAACTTCTCTGTTCTCCACTTTTCAACAAATGTATAGAAGCAATCAGAACACTCTTAAAACAAAGTGGATTTACAGCAGATGATATTAACAAGGTTGTCCTTTGTGGAGGGTCCTCTCGAATTCCAAGGCTACAGCAACTGATTAAAGACCTTTTCCCAGCCGTTGAGCTTCTGAATTCGATCCCTCCTGATGAGGTTATCCCCATTGGTGCAGCCATAGAAGCAGGAATTCTTATTGGGAAAGAAAACCTTTTAGTAGAAGATTCTCTTAAGATAGAGTGTTCAGCCAAAGATATTCTAGTTAAAGGAGTCGATGAATCAGGAGCCAACAGTTTCACAGTACTGTTTCCATCAGGGACCCCTTTGCCAGCTCGAAGACAACACACATTACAAGCCCCTGGAAGTATATCTTCAGTATGCCTCGAACTCTATGAGTCTGAGGGGAAAAACTCTGCAAAAGGAGAAAACAAGTTTGCACAGGTTATACTCCAGGATTTAGATAAAAAAGAAAATGGGTTACGCGACATATTAGCTGTTCTTACCATGAAAAGGGATGGATCTTTACATGTGACGTGCACAGATCAAGAGACTGGAAAATGTGAAGCGATCACTATTGAGGTGGCATCTTAGTGTTTTAGAGAAACCATGAATGTTTTAGAACTAGAATGTCCACATTATTTGGTTTTGTTTATAAGTGATGTTTATATTACAATACTTTTAAACTGTGTAACCTATGTTTCTA