Transcript asmbl_55279

Sequence
Transcript Sequence for observation asmbl_55279 of TGE0006086:
CTTGTCCCTCCCTACCTGCTGCTCCAGGCTGAGGCTTCCCTAGTGCATCTGTCCGCCGATTCATGTGAGTGACGTCGCGGAGGGTCCCAGGGATTTTCTGCCGTTTCTTGGCAAAAATGGCAAACAATGATGCTGTTCTGAAAAGACTGGAACAGAAAGGTGCAGAGGCAGATCAAATTATTGAATATCTTAAGCAGCAAGTTGCTCTTCTTAAGGAAAAAGCAGTTTTGCAGGCAACTTTGAGAGAAGAGAAGAAACTTCGAGTTGAAAATGCTAAGTTGAAGAAAGAAATTGAAGAATTGAAGCAAGAACTAATTCAGGCAGAAATTAAAAATGGAGTGAAACAAATACCATGTCCACCTAGTACTCTACTGCAAGCTAATTCCACGGTTTCTGAAAATGTGATGCAGTCCGTACTATTAACAACCATGTCTTCTGGTACCAAAGAACAGATAAAAGGAGGAGGAGAAGAAGCAAAGAAGGTGAAAGAGAAAATTGAAAAGAAAGGAGAGAAAAAGGAGAAGAAACCTCAATCAGTAGCAGGAGGTGCTGACTCTAAGCCAATAGATGTTTCCCGTCTGGATCTTCGCATTGGTTGTATCATCACTGCCAAAAAACATCCTGATGCAGATTCTTTGTATGTAGAAGAAATAGATGTTGGAGAAGCAGCCCCAAGAACAGTTGTCAGTGGCCTGGTAAACCATGTTCCTCTTGAACAGATGCAAAATCGGATGGTGATTTTACTTTGTAACCTAAAACCTGCAAAGATGAGGGGAGTACTATCTCAAGCAATGCTGATGTGTGCTAGTTCACCAGAGAAAGTTGAAATCTTGGCACCTCCTAATGGGTCTGTTCCTGGAGACAGAATTACTTTTGATGCTTTTCCTGGAGAGCCTGATAAAGAGCTGAATCCTAAGAAGAAGATTTGGGAGCAGATCCAGCCTGATCTTTACACTAATGATGAGTGTGTGGCTACATACAAAGGAGCTCCCTTTGAGGTGAAAGGGAAGGGAGTGTGTAGGGCTCAAACTATGACGAACAGTGGAATAAAATAAAATTAGAATGCTTCAGTTACTGAAATACATTGGAAAAAACTTTAATAACAATAAAAAGAAATACATTTGTCACTTATACCTAAAATATAACTGGCTCTTTGTGCGCTTTCTCTTCTAGACTTAACTAGTCTTTTACCTGGTGTATATTATTTTCAGTTGATTAGAAAAACACTACGTTTTTACCTATGATTTTTGATCCTTTAAAATGTAGGGAGGAAATGGCCTATGTTTTGTGATGATTTATTTTTTAGCAAG