Transcript asmbl_55278

Sequence
Transcript Sequence for observation asmbl_55278 of TGE0006087:
CTTGTCCCTCCCTACCTGCTGCTCCAGGCTGAGGCTTCCCTAGTGCATCTGTCCGCCGATTCATGATTTTCTGCCGTTTCTTGGCAAAAATGGCAAACAATGATGCTGTTCTGAAAAGACTGGAACAGAAAGGTGCAGAGGCAGATCAAATTATTGAATATCTTAAGCAGCAAGTTGCTCTTCTTAAGGAAAAAGCAGTTTTGCAGGCAACTTTGAGAGAAGAGAAGAAACTTCGAGTTGAAAATGCTAAGTTGAAGAAAGAAATTGAAGAATTGAAGCAAGAACTAATTCAGGCAGAAATTAAAAATGGAGTGAAACAAATACCATGTCCACCTAGTACTCTACTGCAAGCTAATTCCACGGTTTCTGAAAATGTGATGCAGTCCGTACTATTAACAACCATGTCTTCTGGTACCAAAGAACAGATAAAAGGAGGAGGAGAAGAAGCAAAGAAGGTGAAAGAGAAAATTGAAAAGAAAGGAGAGAAAAAGGAGAAGAAACCTCAATCAGTAGCAGGAGGTGCTGACTCTAAGCCAATAGATGTTTCCCGTCTGGATCTTCGCATTGGTTGTATCATCACTGCCAAAAAACATCCTGATGCAGATTCTTTGTATGTAGAAGAAATAGATGTTGGAGAAGCAGCCCCAAGAACAGTTGTCAGTGGCCTGGTAAACCATGTTCCTCTTGAACAGATGCAAAATCGGATGGTGATTTTACTTTGTAACCTAAAACCTGCAAAGATGAGGGGAGTACTATCTCAAGCAATGCTGATGTGTGCTAGTTCACCAGAGAAAGTTGAAATCTTGGCACCTCCTAATGGGTCTGTTCCTGGAGACAGAATTACTTTTGATGCTTTTCCTGGAGAGCCTGATAAAGAGCTGAATCCTAAGAAGAAGATTTGGGAGCAGATCCAGCCTGATCTTTACACTAATGATGAGTGTGTGGCTACATACAAAGGAGCTCCCTTTGAGGTGAAAGGGAAGGGAGTGTGTAGGGCTCAAACTATGACGAACAGTGGAATAAAATAAAATTAGAATGCTTCAGTTACTGAAATACATTGGAAAAAACTTTAATAACAATAAAAAGAAATACATTTGTCACTTATACCTAAAATATAACTGGCTCTTTGTGCGCTTTCTCTTCTAGACTTAACTAGTCTTTTACCTGGTGTATATTATTTTCAGTTGATTAGAAAAACACTACGTTTTTACCTATGATTTTTGATCCTTTAAAATGTAGGGAGGAAATGGCCTATGTTTTGTGATGATTTATTTTTTAGCAAG