Transcript asmbl_55093

Sequence
Transcript Sequence for observation asmbl_55093 of TGE0006078:
GATGGGCGCCCTGCGCGCTGACTGGCTGAGAGGCACGCGCGGCAGGGAGGGGAGGGGCGTACGCAGAGCCGCTGTAGTCTCGCGCGGCGGTTGCGAGCGCGTGAGGGACCTGTGCTGCGTTGCGTGCGGTTAGGCAGCAGCGGCAGCAGGAGCAGCAGCAGCTGTGTATAGGAGTCATGAAACACCACGAGGTGGAGATTCTGGACGCGAAGACACGGGAGAAGCTGTGCTTCTTGGACAAGGTGGAGCCCCATGCCACCATCGCCGAGATCAAGAATCTTTTCACTAAGAGCCATCCGCAGTGGTACCCTGCCCGCCAGTCCCTCCGTCTGGACCCTAAGGGCAAGTCCCTGAAGGATGAGGATATTCTGCAGAAGCTGCCTGTGGGTACCACGGCCACACTTTACTTCCGAGACCTGGGGGCCCAGATCAGCTGGGTGACGGTGTTCCTGACAGAGTACGCGGGGCCCCTTTTCATCTACCTGCTCTTCTACTTCCGGGTGCCCTTCATCTATGGCCACAAATATGACTTCACGTCCAGCCGGCACACGGTGGTGCACCTCGCTTGCATCTGCCACTCATTCCACTACATCAAGCGCCTTCTGGAGACACTCTTCGTGCATCGCTTCTCTCATGGCACCATGCCCTTGCGCAACATCTTCAAGAACTGCACCTACTACTGGGGCTTCGCTGCGTGGATGGCCTATTACATCAACCACCCTCTCTACACGCCCCCCACCTATGGAGCTCAGCAGGTTAAACTGGCACTTGCCATCTTTGTGATTTGTCAGCTGGGCAATTTCTCCATCCACATGGCCCTGCGGGACCTGCGGCCAGCAGGGTCCAAGACCAGGAAGATCCCCTACCCCACTAAGAACCCCTTCACATGGCTTTTCCTGCTGGTGTCCTGCCCCAACTACACCTATGAGGTGGGGTCCTGGATTGGCTTTGCCATCATGACACAGTGTCTCCCAGTGGCCCTCTTCTCCCTGGTGGGCTTCACCCAGATGACTATCTGGGCCAAGGGCAAGCACCGCAGCTACCTGAAGGAATTCCGAGACTACCCACCCCTGCGCATGCCCATCATCCCCTTCCTGCTCTGAGCTGCCCACCCCACTGGCTAGGCTCCGCCAGGCTTTCATCCCCCCACCCCTTGTCCTTTTGGGAGAGAAGTGAGGACCACTGCTCTTCAGCGCATGGAATAAAACCTGCCTGCATAGCCGGA