Transcript asmbl_55046

Sequence
Transcript Sequence for observation asmbl_55046 of TGE0006067:
CGCGCGGCGCGGCTGGGCGCTAAGATGGCGGCGGCGTGAGTTGCATGTTGTGTGAGGATCCCGGGGCCGCCGCGTCGCTCGGGCCCCGCCATGGCCGTCACCATCACACTCAAAACGCTGCAGCAGCAGACCTTTAAGATCCGCATGGAGCTTGACGAGACGGTGAAGGTGCTAAAGGAGAAGATAGAAGCTGAGAAGGGACGTGATGCCTTCCCCGTGGCTGGACAGAAACTCATTTATGCTGGCAAGATCCTGAGTGATGATGTCCCTATCAGGGACTATCGCATAGATGAGAAGAATTTTGTGGTTGTCATGGTGACCAAGGCTAAAACCAGCCCAGGCACATCAGTACCCCCAGAGGCTTCACCCACTGCTGCTCCAGAGTCCTCCACGTCCTTCTCGCCAGCCCCTGCTTCAGGCATGTCCCATTCCCCACCTACCGCCAGAGAAGACAAGAGCCCATCGGAGGAATCGGTCCCCACGACATCCCCGGAGTCTGTGTCAGGCTCTGTTCCTTCTTCAGGTAGCAGCGGGCGAGAGGAAGACGCGGCCTCCACACTAGTGACTGGCTCTGAGTATGAGACGATGCTGACGGAGATCATGTCCATGGGCTATGAGCGGGAACGGGTCGTGGCCGCCCTGAGAGCCAGCTACAACAACCCCCACCGAGCCGTGGAGTATCTGCTCACGGTGAGGTGGGGCTGCTGCCTCCTTGGGAGGCTTTCAAGGAATACCTGGGCTTCAGCACCCTGATGGGTGGTCAGGAAGACAAACCCTGCCCCCCGAAGCCTTTGGGTCATGGTACCAGCCAGGAAAGGCTTCTTGTAGGAGGCCAGACATGGGCAGAGAGGTGGGCCCGTGGAGGGCGGGGCTGACGTCTCACCTGTCTCCTGCCAGAGCTGAGTGTGCAGGAGGGAGGCAGCGGGTGGTCTGTGCATTAGAACTAAATAGGACCCCTGACAGGGAATTCCTGGGAGCCCCGAGCCAGAACATGGTTCTGTCCAGGAGAGCCAGGTGTCCGAGCAGCCAGCTACAGAAGCAGCGGGAGAGAACCCCCTGGAGTTTCTGCGGGACCAACCCCAGTTCCAGAACATGCGGCAGGTGATTCAGCAGAACCCGGCGCTTCTGCCTGCACTGCTCCAGCAGCTGGGCCAGGAGAATCCACAGCTTTTGCAGCAAATCAGCCGGCACCAGGAGCAGTTTATTCAGATGCTGAATGAGCCTCCTGGGGAGCTAGCAGACATCTCAGATGTGGAGGGTGAGGTGGGTGCCATAGGCGAGGAGGCCCCGCAAATGAACTACATCCAGGTGACGCCGCAGGAGAAAGAAGCTATAGAAAGGTTGAAGGCCCTGGGCTTCCCAGAGAGTCTGGTGATTCAGGCCTACTTCGCCTGTGAAAAAAACGAGAACTTGGCTGCCAACTTTCTCCTGAGTCAGAACTTTGATGACGAGTAATGCCGGGAGGCCAGGCTGCCTACCGCCCCACCCCTAACCCCAACTCCAAAAAAGTTTTATAAAAGAAAAAATATATATATATATTCATGTTTATTTAAGAAGTGGAAAAAAATCAAAAACCTTAAAAAAAAAACAGAAAAAAAACACCTCAATTTCCACCCTCCTCAAATGGCCCCCATTCCCATCTTGGCCTGAGAAGACCTGGGCCAGACAGCTGTCCTCCCATCCCCCACCCCAGCCTGCTTCAAGGAGCTGGCAGGACCGGAGGTGACAGATGGGCCCCTCTTGGCCTCTGTCCCAGCTCCCTGCAGCCAGATGGAGAGGCGGCTGCTTGCTTCCCCATCCCCCAAAGCCTGAGACCACCCCCACCCTCTTTCAGGGTGACGGGAAGCCAGAGCCCCAAACTTTGATCCTCCATTGGAGTGGTCCAAATCTTTCCATCTGGGGTGAGCAGTCAGAGACCCAAGTCCCACTCTGCAGTCTGGTCTTGGCTTCCAGCCTGCATCCCTTCACTGGGGAGGAGGCGGCCAGGTTTGTCCTAAGGAAGGGGTAACATCAGAGCTGTTCTAGAAGTCAAGGCCACCCCCACCCCAGAACAGAACCGTGTCTCTGATAAAGGTTTTGAAGTGAATAAAGTTTTAAAAGCCCA