Transcript asmbl_10429

Sequence
Transcript Sequence for observation asmbl_10429 of TGE0003534:
GTCGGCTGCGCACGCGCGGTGAGGCCCGACTGGGCGACCTTCAGCGGGGCCGGTAGCACCATGTTTTCTCGGGCGGGCGTCGTTGGGGTCTCGGCCTGGGCCGTGCAGCCGCAATGGATCCAAGTTCGAAATATGGCAACTTTGAAAGATATTACCAGGCGACTAAAGTCAATCAAAAACATCCAGAAAATTACCAAGTCTATGAAAATGGTGGCAGCAGCCAAATATGCCCGAGCTGAGAGGGAGCTGAAACCGGCTCGCGTGTATGGAATAGGATCTTTGGCTCTTTATGAAAAAGCTGACATTAAGGGGCCCGAAGACAAGAAGAAACACCTCCTGATCGGAGTGTCCTCGGACAGAGGCCTTTGTGGTGCCATCCACTCCTCTGTCGCTAAGCAGATGAAAAACGAGGTGGCTACACTCACGGCGGCCGGGAAGGAAGTTAAGATTGTTGGAGTTGGCGATAAAATTAGGGGTATACTTCATAGGACTCACTCTGACCAGTTTCTGGTGACATTCAAAGAAGTGGGAAGAAAACCTCCCACTTTTGGAGACGCGTCGGTCATCGCCCTGGAATTACTAAACTCTGGCTATGAGTTTGATGAGGGGTCTATCATCTTTAATCAGTTCAGGTCTGTCATCTCCTACAAAACAGAAGAAAAGCCCATCTTTTCCCTCAATACCATTGCGAGTGCTGAGAGCATGAGCATCTACGACGACATTGATGCCGACGTGCTGCAGAATTACCAGGAGTACAGTCTGGCCAACATCATCTACTACTCTCTCAAGGAGTCCACTACGAGCGAGCAGAGCGCCAGGATGACGGCCATGGACAACGCCAGCAAGAACGCTTCTGAGATGATTGACAAGTTGACTTTGACTTTCAATCGCACGCGTCAAGCTGTCATCACAAAGGAGTTGATCGAAATCATCTCTGGTGCTGCGGCTCTGTAAGTAACTGCAGATGGCCTGCGGAGAGTTGGTTCTCATCTCTGTGTCTGCTGGTTTAAGCTTGGGATGTTTGAAAGTTTTTGCGTGTGTTTTGTCTGTTAAAGAGGAAATGATCCATTAATCTTGTAACC