Transcript asmbl_10162

Sequence
Transcript Sequence for observation asmbl_10162 of TGE0003530:
GCCGCCGCGACCGTCTCGCCGGCGCTCCGCGGGTAAGCGCTCCTGCCCGAGCCTCGCGGGATCAGCTTTTCCCTGGTTGCGGGCGTTTCCGTACTGTCGCCCCCTTCACCTTGGATCATGTTCAAGAAATTCGACGAGAAGGAAAACGTGTCCAACTGCATCCAGCTGAAAACGTCCGTTATTAAGGGCATTAAGAACCAGTTGACAGAGCAGTTTCCAGGCATCGAACCGTGGCTTAACCAAATCATGCCCAAGAAAGACCCCGTCAAAATAGTGCGGTGCCACGAGCACATAGAGATCCTCACGGTCAACGGGGAGCTGCTGTTTTTTAGACAAAGAGAAGGGCCTTTTTACCCGACGCTGAGGCTGCTCCACAAGTACCCGTTTATCCTGCCGCGCCAGCAGGTGGATAAAGGAGCCATCAAATTTGTCCTCAGTGGCGCGAACATCATGTGTCCAGGCCTGACGTCTCCCGGGGCCAAGCTGTACCCTGCCGCGGTGGATACGGTGGTGGCCATCATGGCGGAAGGAAAACAGCACGCCCTGTGTGTCGGAGTCATGAAGATGTCTGCGGAAGACATCGAGAAAGTCAACAAGGGGATCGGCATCGAAAATATCCATTATCTAAACGACGGACTGTGGCACATGAAGACGTATAAATGAGCCGCAGAAGGAGTGCGCCTGCGCCGATATGGACATTGTGCTGTGGCTGTGTTTGTGTCTGTGTGGCGGTATGAAGACGGTACCTCTGTGGTTACGTCGAATAAATTCAATGGATGCT