Transcript asmbl_54338

Sequence
Transcript Sequence for observation asmbl_54338 of TGE0006025:
GCTACGCCCTGACAACAGCGGGGTCTCTGACTACGCTGGGGTGGGCTACCGTGGGCCTCCGGGCGGCGGTCAACGATGCTGAAGGCCAAGATCCTCTTCGTGGGGCCCTGCGAGAGTGGAAAAACCGTTTTGGCCAACTTCCTGACAGAATCTTCTGACATCACCGAATACAACCCAACCCAAGGAGTGAGGATCCTGGAGTTTGAGAACCCACATGTTACCAGCAACAACAAAGGCACCGGGTGTGAATTTGAACTATGGGATTGTGGCGGTGATCCAAAATTTGAGTCTTGCTGGCCAGCCTTGATGAAGGACTCTCACGGAGTGGTGATCATCTTCAATGCTGACATCCCAAGCCACTTGAAGGAAATCGAGATGTGGTATTCCTGCTTTGTCCAGCAGCAGTTCCTGCAGGATACTCAGTGTCTGTTAATTGCACACCACAAACCAGGCTCTGGAAGTGGTAAAGGAAACCTATCTTTGTCGCCACCCTTGAACAAGCTGAAGCTGGTACACTCAAATCTTGAGGATGACCCTGAAGAGATCCGGATGGAATTCATAAAGTATTTAAAAAGCATAATCAACTCAGTGTCTGAGAGCAGAGACCGGGAGGAGATGTCCATTATTACCTAACCAGCCTTCATCTGGACTCTTCTGCATCCCAAGTGAGGTCAACTTCTTTCCCAGTGCAGATCTGAAATCTTACCCAGTTACTGATGTTTTCTTCTCCCAATGGCCCTTGAAAAAATTTTCCTTCCCTGCTTGCAGGTACCAGTTGCCCAGGGAGTTGAATCATACAATCTAAGCCCTGTCCTTAGTTCAGGTGAGAAAATCCTGTTACTGAATTTTGATTTCTTTGCCCCAGGTTGCTTCAAAGAGCTGGAAAACTGAGGTGTTTTGTTTTCCCCTTCACATATGTCAAGTTATAAAACTTGTGGAATTGTAACTGTCATAGCCTAATCCATGCGTATTGGTTTGAATGTGATTTTCATTTCTTAATTCACTCAACAAATAGCGAC