Transcript asmbl_54325

Sequence
Transcript Sequence for observation asmbl_54325 of TGE0006023:
GCTCTCGCGAGGCCAGGGGAAGTGCAGCCAAGAACCCCTGTGCAGTGTGGAGGTCGTAGGAGTCACTTACTCACCGCCAGGTCCTTCGCTTGCTGGTCCGCGCCCCGCCCGCCGCAGCCATGCTCTCAGCCCTTGCCCGGCCTTCCGGCGCCGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAGGTAGCCGTGCTCGGGGCTTCTGGAGGAATTGGGCAGCCCCTTTCACTTCTCCTGAAGAACAGTCCTTTGGTGAGCCGCCTGACCCTCTACGATATTGCTCATACGCCTGGAGTGGCGGCGGATCTGAGCCACATCGAGACCAGAGCAAATGTGAAAGGCTACCTCGGACCTGAGCAGCTGCCCGAATGCCTGAAAGGTTGTGATTTGGTGGTTATTCCAGCCGGAGTCCCAAGAAAACCAGGCATGACACGGGATGACCTGTTCAACACCAATGCCACAATTGTGGCCACCTTGACTGCTGCGTGTGCTCAACATTGCCCTGACGCCATGATCTGTGTCATTGCAAATCCGGTCAACTCCACCATCCCAATCACGTCAGAAGTTTTCAAGAAACATGGAGTATACAACCCCAGTAAAATCTTTGGGGTGACGACCCTGGATATTGTCAGAGCCAACACTTTTGTTGCAGAACTGAAGGGTTTGGATCCAGCTCGAGTCAATGTCCCTGTCATTGGCGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCAGTGCACTCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCGCTTACTGGGCGGATCCAGGAGGCTGGCACGGAGGTGGTCAAGGCTAAAGCTGGAGCAGGCTCTGCCACCCTGTCCATGGCATATGCCGGAGCCCGGTTTGTCTTTTCCCTTGTGGATGCAATCAACGGAAAGGAAGGAGTGGTTGAATGTTCTTTTGTTAAATCCCAAGAAACGGACTGTCCCTATTTCTCCACACCATTGCTGCTTGGAAAAAAGGGCATCGAGAAAAATCTAGGCATTGGCAAAGTTTCCCCTTTTGAAGAGAAGATGATAGCTGATGCCATTCCTGAGCTGAAAGCCTCAATCAAGAAAGGAGAAGAGTTTGTGAAGAACATGAAATGAGAAAACTGTTAGCAGGCAGTCCATTTCCTTAACTTATTAAGGCATTCTGTCACTGTAAAGCATTTCAGATTTCTTTGTATTTCATTTTGCTTTAACGATGAATATTGTATTAATGTTACCATCCCTTCCTAGTTGCGGATCAGTCTATTGGTGCATCAATAAAAGTAGGCTTTGATTTTCTTTTTCAAGGTCTCTGCCATAAA