Transcript asmbl_54136

Sequence
Transcript Sequence for observation asmbl_54136 of TGE0006011:
CCTCTCTCTACCTCAGCAGAAGCCGCCGGGGTCTTCTTGGAGTCTAACTGTTGTAGACGCCCACCCGCTGTGCAGTTGCGATGCCGCGTGGTAGCCGAAGCCGCACCTCCCGCATGGCCCCGCCGTCCAGCCGGGCACCTCAGATGAGAGCTGCGCCCAGACCAGCGCCAGCAGCCCAGCTGCCAGCAGCAGCTCCACCATCTGCTGTTGGCTCACCTGCTGCTGCACCCCGGCAGCCAGGTCTGATGGCCCAGATGGCAACTACTGCAGCTGGTGTAGCTGTGGGCTCTGCTGTTGGCCACACGCTAGGTCATGCCATCACTGGGGGCTTCGGTGGAAGTAACACTGAGCCCTCAAGGCCTGACATCACTTACCAGGAGCCACAGGGAACCCAGCCGGCATACCAGCAGCAGCAGCAGTTTGGCCCATGCCACTATGAGATGAAACAGTTTTTGGAGTGTGCCCAGAACCAGGGTGACCTTAAGCTTTGTGAGGGTTTCAGCGAGGTGCTGAAACAGTGCAGATTTGCAAATGGATTAGCCTAATCAAGAAGTTCAAATTGAAGACATGGAAAATCATCTCTCACGACCAAGTTAATTTAGTATAAAAATATAATGGATAGTGAAAGTATAAAGTGTAAAACCACCAGTTAAACCTCTCTATTATTAATAGCTTCCTTGCCTCAGAATTGCAGTGGAAGAGAGTGTTCATACTGTATAGTTCATTGAGATGGTATTGAGTTTGGGGTTGGGCAGATGGTTTTGTGGGCTCCTTAAACCAGGTTTTGTGATGTTATTTGTGAATCGATTAGAATAAAGTGATTTTCTTCCAAAA