Transcript asmbl_10120

Sequence
Transcript Sequence for observation asmbl_10120 of TGE0003523:
CGCGTGGCTCCGAGTGCGCCTGCGCGGAGCGCCGGGACAGGGCGTGTTCCTCGTTCGGGTGCGCGTCTACCTCAGGCGGGCTGCGGTTTTCCCTCCCCGCAGTCGTGCGCCCTGCGGGACCCCGTCATTTCTACGCCCAGCCTGATACGTGCCGCTCTCCGCGATCATGTCCAAGTCTCTGAAAAAGTTGGTGGAGGAGAGCCGGGAGAAGAACCAGCCGGAAGTGGACATGAGTGACCGCGGCATCTCCAACATGCTGGATGTCAACGGCCTGTTCTCCTTATCCCACATCACGCAGCTGGTCCTCAGCCACAACAAGCTAACAACCGTGCCACCTAACATAGCGGAACTGAAGAATCTGGAAGTGCTCAACTTTTTTAACAACCAGATTGAGGAGCTGCCCACACAGATCAGCAGCCTTCAGAAACTCAAGCACCTGAACTTGGGCATGAACAGACTAAACACTTTGCCTCGAGGATTTGGCTCCCTCCCAGCCCTTGAGGTCCTTGATTTGACTTACAACAACTTGAATGAAAATTCTCTTCCTGGAAATTTCTTCTACCTGACCACCCTGCGTGCACTCTATCTAAGTGACAACGATTTTGAAATCCTGCCGCCAGATATTGGGAAGCTCACAAAGTTGCAGATACTCAGCCTTAGGGATAACGACCTGATCTCGCTGCCTAAGGAAATCGGGGAGCTTACTCAGCTTAAGGAGCTCCACATTCAGGGGAACCGCCTGACCGTTCTGCCCCCAGAACTAGGAAACTTGGATCTGACTGGTCAGAAGCAGGTATTCAAAGCAGAGAACAACCCCTGGGTCACCCCGATCGCTGACCAGTTCCAGCTTGGTGTGTCCCATGTATTTGAGTATATCCGTTCCGAGACGTACAAGTATCTCTACGGCAGACACATGCAGGCAAATCCAGAACCGCCGAAGAAAAATAATGACAAAACGAAAAAGATCAGCCGGAAGCCTCTGACAGCCAAGAACAAATGAGGGGTTGGCATGGGCTGGACTTCCGGTCACTTCGCTCGTTATTACTTCTGTTCTCTTGCTCTGTCCCACGATCAGTTATGGTTGACCCTTGAGCAACTTGGGTTTGAACTGAGCGGGTCCATTATATGCAGATTTTCTTCAATAAATTCTGCAAATGTATTTTCCTAATGATTCTCTTAAGATTTTCTTTTCTCTAACTTTGGTATAAGAATACAGTATATAATATGTATAACATACAAAATAGGTGTTAATAGACTGTTTACGTTAATAGACAGGAGGCTATCAGTAGTAAAGTTTTGGGGTGTCAGGTTATATGTGGATTTTCAACTGTGTAAGGGGGCGGCACCCCAACCCTCACATTGTTCAAGGGTCAACTGTACAGTGTGTATCTCTGAGTGTGTGTGAGTGCATGTGTTTCTTTTCATATTTTTCTTCCTACTGCTTACCAATTTTTATCTTTTAATTTCTTTTGGTAGGTAGTAGATTTTTATAAGTTTTAAAAACCCTTTCTTACCTTAAAAATTACCAAAGGCAGGAAACAAAGCTCTGATTCAACTGCTAATTCCGTAGTAGGCACTGATTTCAGCTCCTTGAATAGATGCTCGTAAAGTCGCTGCTTATCAAAAGCATAATTAAAATCACGTAATCGTTTAAATGTCACAGCACTGTTCACGCTTCTGTTTATTCATGTAATTCATTCTTTCGCCTTATTAAAAATTTTCCTTCGCCACTGAGATATTATGTTAACTTTCTTCACATACGATTTTAATAAAATCTTGAATTTGCACAACGTGTTGCCTCCTGAATACAGAACAATCTGACTTTGGGGTGTATACACATTTTTGTTTACTCTTTTTCCCAAAATTAATCTTGTCCACTTTTATTGGTTGTAGATGATAAACCCTGAAACTTCTCATGAAAAAAATGCAAAATTAAAGTTAGTTTCTTCTCA