Transcript asmbl_53458

Sequence
Transcript Sequence for observation asmbl_53458 of TGE0005955:
CGCGAGGCGCGCAGGCGCCTTGGGGACCCGGTAGCGGCGGTGGCAGTGGCTGCGGCGACGGGATCCTTGGCCGAAACTGAAGGCGGTGGTGGCGGCCATGGCGGCCGATGGAGAGCGATCCCCGCTGCTCTCCGAGCCCATCGATGGTGGTGCTGGCGGCAATGGATTAGTGGGACCAGGCGGGAGTGGGGCTGGGCCCGGGGGAGGCCTGACCCCCTCCGCACCACCGTACGGAGCCGGTAAACATACCCCGCCCCAGGCATTTCCCCCATTCCCTGAGGGACATCCAGCCGTGTTGCCTGGGGAGGACCCACCCCCCTACTCACCCTTGACTAGCCCGGACAGTGGGAATGCTCCCATGATCACCTGCCGAGTCTGCCAGTCTCTCATCAACGTGGAAGGCAAGATGCATCAGCATGTAGTCAAATGTGGCGTCTGCAATGAAGCCACTCCAATCAAGAATGCACCCCCAGGGAAAAAATATGTTCGATGCCCTTGTAACTGTCTCCTTATCTGCAAAGTAACTTCCCAGCGGATTGCCTGCCCTCGACCCTACTGCAAAAGAATCATCAACCTGGGGCCTGTGCACCCAGGACCTCTGAGTCCAGAACAACAACCTGTAGGTGTCAGGGTCATCTGTGGACATTGCAAGAATACTTTTCTGTGGACGGAGTTCACAGACCGAACCTTGGCCCGTTGCCCTCACTGCAGGAAAGTGTCATCTATTGGGCGCAGATATCCACGAAAGAGGTGTATCTGCTGCTTCTTGCTTGGCTTACTCTTGGCAGTCACTGCCACTGGCCTTGCCTTTGGGACATGGAAGCATGCACAGCAATATGGAGGCATCTATGCAGCCTGGGCATTTGTGATCCTGTTGGCTGTGCTGTGTTTGGGGCGGGCCTTCTATTGGGCCTGTATGAAGGTCAGCCACCCTGTCCAGAACTTCTCCTGAGCCCCATGATCACCCACAGACTGTGCCTGGCCCCTTCCTGGTGGGGACAGTGACACTACAAAGGGAACCATAATCAAAGGCTCCCTGGGCTTCTATAAGGGAAGCCAAGCAGCTGCCTTCCTTTTCCCTGGCGAGAGGTAGGAAGGGACCAGGCCCTCACCTAGGTTTGGAGGGGTAGAAAAGGCCACTGTTGGCCTGGCCACCTGCTTTCCTCCAAGAGTTGCTATGTTTAGGGTGAGGTAGGTGAAATGTTGCCCCTAAACCTGGGTCATAAAAGATGGTTCTAGCCATGTCCTTCCTATGTGCTCCCTGAGAGCCATTCCTGTCCCTTACACATTCCAGGGCAGGGTGGGGGTGGGTAGCCCTGGGGGTTTCCCTCCCTCTTGTGTACCATTAGGACCTTGCTGCTGCTATTGCACTTCACCAGGGGCTGGCTCTGGCCTCAGTACCCTCAGTCTCCTCCCCCCATTCCATGTCCTATGGGGGTGGGGTCAGCCGCTGCTCTGTACAGAACCACAGGAACTGATATGTATATAACTATTTAATATGGGGAATGTCCCCCTAGTCCTGTGTTTCCCTTAATTCCTCCTTCCAACCTTACTCCCCAGTGTATTTAACTGGGCTGGGTAGGGTTGCTCTGTTGTGGGGGAGGTTAGGGATTCATCCTGTGCTTGTAAATAAAT