Transcript asmbl_5344

Sequence
Transcript Sequence for observation asmbl_5344 of TGE0005748:
CTGCGGTGAAGGAGAGGTGCGCGGCTGGCGGTTTCCAGACTCGGGTCCTGGGAAGGCGGCGAAGAGAGGGGCCAGAGGGCTGGAAGACTGAGTCCCAGCGGAGGGCGAGCCGGATCACGCCGCCATGCCTCGCTCTGGGTCGCGAGCAGTCTTCCTCCTCTTGTCGCCGCTGCTGCTGCTCCGCGCTGTTTTGACTGTGCCCCTGGAGCGAGGGGCGCCCAAGGAGGAGAGCCCCGCGACCGAGAGCCCCGACACGGGCCTGTACTACCACCGGTACCTCCAGGAGGTCATCAATGTCCTGGAGACTGATGGGCACTTCCGCGAGAAGCTGCAGGCCGCCAATGCCGAGGACATCAAGAGCGGGAAGCTGAGCCGGGAGCTGGACTTTGTCAGCCACCACGTCCGCACCAAGTTGGACGAGCTCAAGAGGCAGGAGGTGTCGCGGCTTCGGATGCTGCTCAAGGCCAAGATGGACGCAGAGCAGGAGCCCAATGTACAGTTGGACCACTTGAGCCTCCTGAAGCAGTTCGAACACCTGGACCCTCAGAACCAGCACACATTTGAGGCCCGAGACCTGGAGCTGCTGATCCAGACGGCCACCCGCGACCTTGCCCAGTACGACGCGGCCCATCACGAAGAGTTCAAACGCTACGAGATGCTCAAGGAACACGAGAGACGCCGTTATCTGGAGTCACTGGGAGAGGAGCAGCGGAAGGAGGCAGAGAGGAAACTGGAAGAACAACAGCGACGGCACCGAGAGCACCCCAAAGTCAATGTGCCTGGCAGCCAAGCTCAGTTGAAGGAGGTGTGGGAGGAGCTGGATGGATTGGACCCCAACAGGTTTAACCCCAAGACCTTCTTCATACTGCATGATATCAACAGCGATGGTGTCCTAGATGAGCAGGAGCTGGAGGCCCTCTTCACCAAGGAGCTGGAGAAGGTATATGACCCGAAGAATGAGGAAGACGACATGCGGGAGATGGAGGAGGAGCGACTGCGCATGCGGGAGCACGTGATGAAGAATGTGGACACCAACCAGGACCGCCTCGTGACCCTGGAGGAGTTCCTCGCATCCACCCAGAGGAAGGAGTATGGGGACACCGGGGAGGGCTGGGAGACGGTGGAGATGCATCCTGCCTACACGGAGGAAGAGCTGAGGCGTTTCGAGGAGGAGCTGGCCGCCCGGGAGGCAGAGCTGAATGCCAAGGCCCAGCGCCTCAGCCAGGAGACAGAGGCTTTGGGGCGCTCCCAGGACCGCCTGGAGGCCCAGAAGAGAGAGCTGCAGCAGGCGGTTATGCAGATGGAGCAGAGGAAGCAGCAGCAGCAGCAGCAGCAG