Transcript asmbl_10102

Sequence
Transcript Sequence for observation asmbl_10102 of TGE0003521:
GGTGGATCTGTAGAGAGACCAGCTGACTAGGAGAGGGAGGGGAGGAGCCCAGCTGTGAGGTGTGTGAGCCTAAGAACCATGTCTACGCGGGAGTCCTTTAACCCAGAAAGTTATGAATTGGACAAGAGCTTCCGGCTAACCAGATTCACTGAACTGAAGGGCACTGGCTGCAAAGTGCCCCAAGATGTCCTGCAGAAATTGCTGGAATCCTTACAAGAGAACCACTTCCAAGAAGATGAACAGTTTCTGGGAGCAGTTATGCCAAGGCTTGGCATTGGGATGGATACTTGTGTCATTCCTTTGAGGCATGGTGGTCTTTCCTTGGTTCAAACCACAGATTACATTTATCCTATCGTCGATGACCCTTACATGATGGGCAGGATAGCATGTGCCAATGTTCTCAGTGACCTCTATGCAATGGGGGTCACAGAATGTGACAATATGCTGATGCTCCTTGGAATCAGTAATAAAATGACCGACAGGGAAAGGGATAAAGTGATGCCCCTAATTATACAGGGTTTTAAAGATGCAGCAGAGGAGGCAGGAACGTCTGTAACGGGCGGCCAAACAGTGTTAAACCCCTGGATTGTTTTGGGAGGAGTGGCTACAACTGTCTGCCAGCCCAATGAATTCATCATGCCAGATAACGCAGTGCCTGGGGACGTGCTAGTGCTGACGAAGCCCCTGGGGACGCAAGTGGCCGTGGCCGTGCACCAATGGCTGGATATTCCTGAAAAATGGAATAAAATTAAATTAGTGGTGACCCAAGAAGACGTGGAGTTGGCATACCAGGAGGCCATGATGAACATGGCAAGGCTCAACAGGACAGCTGCGGGACTCATGCACACGTTCAACGCCCACGCCGCCACCGACATCACGGGCTTCGGGATTCTGGGCCACGCGCAGAACCTGGCCAAACAGCAGAGGAACGAGGTTTCCTTCGTGATTCACAACCTCCCCGTCCTGGCCAAGATGGCTGCTGTGAGCAAGGCCTGTGGGAACATGTTTGGCCTCATGCATGGGACCTGCCCCGAGACATCAGGTACAAGGATCCTGGGCCCAAATCCGAGGATTAACTAGTGAGGCTAATGGAAAGTGCCATGAGAAGGAAGAAGCCAAGTACGTGAGCATGACCCCCTTTTGTGTGAGGAGGCCTTCTAATCTGTTTACCACGTGAGCAAGCTGCTCGGTTCTGTGCAGAGATAAAGTCCCCCAAATATGGTGAAGGTCACCAAGCATGGATTATTGGGATCGTAGAGAAGGGCAACCGTACCGCCAGAATCATAGACAAACCCCGGATCATTGAAGTCGCACCACAGGTGGCCACTCAAAATGTGAATCCCACACCTGGTGCCACCTCTTAATCCAGACCGAAATAGCTATTTGGTTTTGTTTTTAAATAGATCTATTTCCTTTATCATCATTTCAATTAAAGACTATAAACAACAAC