Transcript asmbl_10101

Sequence
Transcript Sequence for observation asmbl_10101 of TGE0003520:
NNNNNNNNNNCCGCCGCGCCGCACAAAGAGCCCAGGGCCGGCCGGCCTTTAAAGGTGGCAGCCTGCGATTTAAGGTGTCCCCGAGTTCCGTGGCCCGCGCTCCGGCGGCCTCGACGTGTGCTTCTATGCGAGCGCCTGGCCGCTGCACCCACGTTGCCGCGGCCCCCCCATTGTTGATGTCCTGAGTTTAGGAGCTTGGGGGGTAGGTGGATCTGTAGAGAGACCAGCTGACTAGGAGAGGGAGGGGAGGAGCCCAGCTGTGAGGTGTGTGAGCCTAAGAACCATGTCTACGCGGGAGTCCTTTAACCCAGAAAGTTATGAATTGGACAAGAGCTTCCGGCTAACCAGATTCACTGAACTGAAGGGCACTGGCTGCAAAGTGCCCCAAGATGTCCTGCAGAAATTGCTGGAATCCTTACAAGAGAACCACTTCCAAGAAGATGAACAGTTTCTGGGAGCAGTTATGCCAAGGCTTGGCATTGGGATGGATACTTGTGTCATTCCTTTGAGGCATGGTGGTCTTTCCTTGGTTCAAACCACAGATTACATTTATCCTATCGTCGATGACCCTTACATGATGGGCAGGATAGCATGTGCCAATGTTCTCAGTGACCTCTATGCAATGGGGGTCACAGAATGTGACAATATGCTGATGCTCCTTGGAATCAGTAATAAAATGACCGACAGGGAAAGGGATAAAGTGATGCCCCTAATTATACAGGGTTTTAAAGATGCAGCAGAGGAGGCAGGAACGTCTGTAACGGGCGGCCAAACAGTGTTAAACCCCTGGATTGTTTTGGGAGGAGTGGCTACAACTGTCTGCCAGCCCAATGAATTCATCATGCCAGATAACGCAGTGCCTGGGGACGTGCTAGTGCTGACGAAGCCCCTGGGGACGCAAGTGGCCGTGGCCGTGCACCAATGGCTGGATATTCCTGAAAAATGGAATAAAATTAAATTAGTGGTGACCCAAGAAGACGTGGAGTTGGCATACCAGGAGGCCATGATGAACATGGCAAGGCTCAACAGGACAGCTGCGGGACTCATGCACACGTTCAACGCCCACGCCGCCACCGACATCACGGGCTTCGGGATTCTGGGCCACGCGCAGAACCTGGCCAAACAGCAGAGGAACGAGGTTTCCTTCGTGATTCACAACCTCCCCGTCCTGGCCAAGATGGCTGCTGTGAGCAAGGCCTGTGGGAACATGTTTGGCCTCATGCATGGGACCTGCCCCGAGACATCAGGAGGCCTTCTAATCTGTTTACCACGTGAGCAAGCTGCTCGGTTCTGTGCAGAGATAAAGTCCCCCAAATATGGTGAAGGTCACCAAGCATGGATTATTGGGATCGTAGAGAAGGGCAACCGTACCGCCAGAATCATAGACAAACCCCGGATCATTGAAGTCGCACCACAGGTGGCCACTCAAAATGTGAATCCCACACCTGGTGCCACCTCTTAATCCAGACCGAAATAGCTATTTGGTTTTGTTTTTAAATAGATCTATTTCCTTTATCATCATTTCAATTAAAGACTATAAACAACAAC