Transcript asmbl_15073

Sequence
Transcript Sequence for observation asmbl_15073 of TGE0000354:
CGGCGTGGCTCCCGTCTCCGCCCAGTCGTAGGCGCTGGCCGCTGACATGTTGAGGACTACGCGCGGCCCAGGCCTGGGCCCCCCGCTGCTCCAGGCCGCGCTGGGCCTTGGGCGGGCTGGGTGGCACTGGCCTGCGGGCCGGGCGGCGAGCGGGGGGCGCGGGCGGGCCTGGCTGCAGCCCACGGGCCGGGAGACGGGTGTGCAGGTGTACAACAGCCTCACCGGGAGGAAGGAACCCCTAATCGTGGCGCACGCCGAAGCCGCCTCCTGGTATAGCTGTGGACCAACTGTATATGATCATGCGCACCTTGGCCATGCTTGCTCATATGTTAGATTTGATATCATTCGAAGGATCCTAACCAAGGTTTTTGGATGCAGCATAGTCATGGTGATGGGTATTACAGATGTAGATGATAAAATCATCAAAAGAGCCAATGAGATGAATATTTCCCCCGCTTCCCTCGCCAGTCTTTATGAGGAAGACTTCAAGCAGGACATGGCAGCCCTGAAGGTTCTCCCACCCACGGTGTACCTGAGGGTAACCGAAAATATTCCTCAGATAATTTCTTTCATTGAAGGAATCATTGCTCGTGGGAACGCTTATTCAACGGCAAAAGGCAATGTCTACTTCGATCTGAAGTCTAGAGGAGACAAGTATGGCAAATTGGTCGGCGTGGTCCCTGGTCCAGTCGGAGAGCCAGCGGACTCTGACAAGCGTCATGCCAGTGACTTCGCCCTGTGGAAGGCGGCCAAACCCCAGGAGGTGTTCTGGGCCTCTCCCTGGGGACCCGGGAGGCCGGGCTGGCACATCGAGTGCTCTGCCATCGCTAGTATGGTATTTGGAAGTCAACTGGATATCCATTCAGGTGGGATAGATTTAGCTTTTCCACATCATGAAAACGAAATTGCACAGTGCGAAGTCTTTCATCAGTGCGAGCAGTGGGGAAATTATTTTCTGCATTCTGGGCATTTGCACGCCAAAGGCAAAGAAGAAAAAATGTCCAAATCATTAAAGAACTACATTACTATTAAGGACTTTCTGAAGACCTTTTCCCCCGATGTCTTCCGGTTCTTCTGCCTGCGGAGCAGCTACCGCTCAGCCATCGACTACAGTGACAGCGCCATGCTCCAAGCTCAGCAGCTGCTCCTGGGGCTGGGCTCTTTCCTGGAGGACGCACGTGCCTACATGAAGGGGCAGCTGGCCTGCGGCTCCGTCAGGGAAGCGATGCTGTGGGAGAGGCTCTCCAGCACCAAGAGGGCCGTGAAGGCGGCCTTGGCAGATGATTTTGACACACCCAGGGTGGTTGATGCCATCCTGGGCCTTGCACACCACGGGAATGGACAGCTCAGGGCGTCCCTGAAGGAACCTGAAGGGCCGAGAAGTCCTGCTGTGTTTGGTGCCATCATCTCTTACTTTGAACAGTTTTTTGAAACTGTTGGAATTTCTCTGGCAAATCAACAGTACGTTTCAGGAGACGGCAGCGAGGCTACCTTGCATGGTGTGGTGGACGAGCTGGTGCGGTTCCGGCAGAAGGTCCGGCAGTTTGCGCTGGCCATGCCCGAGGCCACGGGGGACGCCCGGCGGCAGCAGCTCCTAGAAAGGCAGCCCCTGCTGGAAGCATGCGACACCCTGCGCCGGGGCCTGACTGCCCACGGCATCAACATCAAGGACAGAAGCAGTACAACATCCACGTGGGAACTGCTGGATCAAAGGACAAAAGACCAAAAATCAGCGGGCTGAGGATGGAGCACAGCCATGAACCTGCTCACGACAAGACGCACCCATGCTTCTCAGGGTCAAGGCTTTATGTTAAAGCTTCCTGTCGGGGCTGCTAGGTCAGCATTAAAGTAAGGCAACCAACAGTG